Microarray experiments to specifically-expressed genes

GSM ID GSM142602
Assay name BD001_ATH1_A6-DAVIE-T14
GSE experiment GSE6149: Targets of the mci genes.

Click Gene ID to show a list of GSM assays in which the gene are specifically expressed.

Std2 GX %ile Std GX Gene ID Repr. ID Gene name Functional description O.I. C.G. H.G. Other DB
91.699.931.4At5g43510834371--O.I.C.G.H.G.
59.999.892.8At1g29510839828SAUR68 (SMALL AUXIN UPREGULATED 68)F:molecular_function unknown;P:response to auxin stimulus;C:unknown;PO.I.C.G.H.G.
37.899.852.3At5g39860833982PRE1 (PACLOBUTRAZOL RESISTANCE1)F:transcription factor activity, DNA binding;P:regulation of transcription;C:nucleus;PO.I.C.G.H.G.
35.899.765.0At2g35190818086NPSN11 (NOVEL PLANT SNARE 11)plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate.O.I.C.G.H.G.
33.799.784.8At2g07708815383unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
32.299.745.8At1g71830843513SERK1 (SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE 1)Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. laterO.I.C.G.H.G.
32.199.769.1At1g02190839541CER1 protein, putativeF:oxidoreductase activity, iron ion binding, catalytic activity;P:oxidation reduction, fatty acid biosynthetic process;C:endoplasmic reticulum;BOPFMVO.I.C.G.H.G.
31.199.713.9At4g14840827141unknown proteinF:unknown;P:unknown;C:cellular_component unknown;MOFBPAVO.I.C.G.H.G.
30.099.7112.5At2g07707815382hydrogen ion transmembrane transporter/ hydrolase, acting on acid anhydrides, catalyzing transmembrane movement of substancesF:hydrogen ion transmembrane transporter activity, hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances;P:ATP synthesis coupled proton transport;C:mitochondrion, vacuole, membrane;POO.I.C.G.H.G.
29.899.713.2At2g21655816704unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PO.I.C.G.H.G.
29.499.743.3At3g46770823830transcriptional factor B3 family proteinF:transcription factor activity, DNA binding;P:regulation of transcription, DNA-dependent;C:cellular_component unknown;PO.I.C.G.H.G.
25.999.716.5At2g40030818591NRPD1BEncodes the unique largest subunit of nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB1 and the E. coli RNA polymerase beta prime subunit. Required for normal RNA-directed DNA methylation at non-CG methylation sites and transgene silencing.O.I.C.G.H.G.
25.899.787.7At5g44630834491terpene synthase/cyclase family proteinEncodes a sesquiterpene synthase involved in generating all of the group B sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in intrafloral nectaries.O.I.C.G.H.G.
25.099.647.3At1g67050843025unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;OMPFBVO.I.C.G.H.G.
24.799.625.9At5g04660830343CYP77A4encodes a protein with cytochrome P450 domainO.I.C.G.H.G.
24.799.67.5At2g35870--O.I.C.G.H.G.
23.899.648.2At5g58440835957SNX2a (SORTING NEXIN 2a)F:phosphoinositide binding;P:signal transduction, intracellular signaling cascade;C:cellular_component unknown;MFOPABO.I.C.G.H.G.
23.099.624.5At1g60060842300unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OPFMBO.I.C.G.H.G.
22.899.655.5At5g21150832241PAZ domain-containing protein / piwi domain-containing proteinF:nucleic acid binding;P:unknown;C:cellular_component unknown;MPFOO.I.C.G.H.G.
22.899.614.4At3g61950825368basic helix-loop-helix (bHLH) family proteinF:transcription factor activity, DNA binding;P:regulation of transcription;C:nucleus;PMFOO.I.C.G.H.G.
22.399.6291.2At1g72260843558THI2.1 (THIONIN 2.1)Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660.O.I.C.G.H.G.
22.199.616.1At4g16970827405ATP binding / kinase/ protein kinase/ protein serine/threonine kinaseF:protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MOPFBVAO.I.C.G.H.G.
22.099.6343.6At1g5766084214260S ribosomal protein L21 (RPL21E)F:structural constituent of ribosome;P:translation;C:ribosome, intracellular;MOAFPO.I.C.G.H.G.
21.999.667.7At1g73960843733TAF2 (TBP-ASSOCIATED FACTOR 2)F:metallopeptidase activity, zinc ion binding;P:unknown;C:cellular_component unknown;MOBFPAVO.I.C.G.H.G.
21.899.633.6At2g26110817151unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;POMFBO.I.C.G.H.G.
20.599.612.8At5g12270831102oxidoreductase, 2OG-Fe(II) oxygenase family proteinF:oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity;P:biological_process unknown;C:cellular_component unknown;POBFMO.I.C.G.H.G.
20.299.686.2At2g29210817470splicing factor PWI domain-containing proteinF:unknown;P:RNA splicing;C:unknown;MOFBPVAO.I.C.G.H.G.
20.199.6122.0At2g02850814816ARPN (PLANTACYANIN)Encodes plantacyanin one of blue copper proteins. Involved in anther development and pollination. Expressed in the transmitting tract of the pistil.O.I.C.G.H.G.
20.199.654.3At3g52030824366F-box family protein / WD-40 repeat family proteinF:molecular_function unknown;P:unknown;C:CUL4 RING ubiquitin ligase complex;MFOPBO.I.C.G.H.G.
20.099.69.9At1g05490837051chr31 (chromatin remodeling 31)F:helicase activity, DNA binding, ATP binding, nucleic acid binding;P:biological_process unknown;C:unknown;MOBFPVAO.I.C.G.H.G.
19.199.637.8At2g42800818880AtRLP29 (Receptor Like Protein 29)F:protein binding;P:unknown;C:anchored to membrane, plant-type cell wall;PMOBFAO.I.C.G.H.G.
18.899.541.8At1g51460841571ABC transporter family proteinF:ATPase activity, coupled to transmembrane movement of substances;P:transport;C:membrane;BOMFAPVO.I.C.G.H.G.
18.599.566.9At2g45950819203ASK20 (ARABIDOPSIS SKP1-LIKE 20)F:ubiquitin-protein ligase activity, protein binding;P:ubiquitin-dependent protein catabolic process;C:SCF ubiquitin ligase complex;MPOFBVO.I.C.G.H.G.
18.599.519.5At1g78950844234beta-amyrin synthase, putativeF:beta-amyrin synthase activity;P:unknown;C:unknown;BPOFMAO.I.C.G.H.G.
18.399.5324.5At3g57690824938AGP23 (ARABINOGALACTAN-PROTEIN 23)Encodes a putative arabinogalactan-protein (AGP23).O.I.C.G.H.G.
18.199.518.2At5g35670833540iqd33 (IQ-domain 33)F:calmodulin binding;P:biological_process unknown;C:unknown;PBMOFO.I.C.G.H.G.
18.099.5219.1At3g2850082248060S acidic ribosomal protein P2 (RPP2C)F:structural constituent of ribosome;P:translational elongation;C:cytosol, cytosolic ribosome, ribosome, plasma membrane;MFOPABO.I.C.G.H.G.
17.699.588.1At2g15560816049-F:unknown;P:response to oxidative stress;C:cellular_component unknown;PMFBOO.I.C.G.H.G.
17.699.530.5At2g18220816337-F:unknown;P:biological_process unknown;C:cellular_component unknown;MOFPBVAO.I.C.G.H.G.
17.299.516.1At5g58782835993dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putativeF:dehydrodolichyl diphosphate synthase activity;P:dolichol biosynthetic process;C:endomembrane system;OBAFMPO.I.C.G.H.G.
16.999.519.9At4g22280828323F-box family proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
16.999.517.2At5g08210830717MIR834aEncodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAAO.I.C.G.H.G.
16.999.515.4At4g32970829434unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOBFO.I.C.G.H.G.
16.899.57.4At5g64710836592unknown proteinF:unknown;P:biological_process unknown;C:unknown;PMBFOAO.I.C.G.H.G.
16.699.512.1At1g14690838034MAP65-7 (MICROTUBULE-ASSOCIATED PROTEIN 65-7)F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOFPBAVO.I.C.G.H.G.
16.599.56.1At4g30870829211MUS81 (MMS AND UV SENSITIVE 81)Encodes an Arabidopsis homolog of the endonuclease MSU81. T-DNA insertion lines of AtMSU81 have a deficiency in homologous recombination in somatic cells but only after genotoxic stress. Crosses with a hyperrecombinogenic mutant of the AtRecQ4A helicase resulted in synthetic lethality in the double mutant.O.I.C.G.H.G.
16.399.526.0At1g76880844023trihelix DNA-binding protein, putativeF:transcription factor activity;P:regulation of transcription;C:unknown;OMPFBVO.I.C.G.H.G.
16.399.514.1At5g23260832390TT16 (TRANSPARENT TESTA16)Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule.O.I.C.G.H.G.
15.899.5125.8At1g14610838023TWN2 (TWIN 2)Required for proper proliferation of basal cells.O.I.C.G.H.G.
15.899.515.1At1g12460837803leucine-rich repeat transmembrane protein kinase, putativeF:protein serine/threonine kinase activity, kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:plasma membrane;MPOBFVAO.I.C.G.H.G.
15.399.44.1At5g48200834873unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
14.999.449.0At1g06230837133GTE4 (GLOBAL TRANSCRIPTION FACTOR GROUP E 4)This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation.O.I.C.G.H.G.
14.999.417.3At2g28870817436unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
14.799.4141.9At2g07698815374ATP synthase alpha chain, mitochondrial, putativeF:hydrogen ion transporting ATP synthase activity, rotational mechanism, poly(U) binding;P:proton transport, ATP metabolic process, ATP synthesis coupled proton transport;C:in 7 components;BOPMAFO.I.C.G.H.G.
14.699.422.9At4g21430827895B160F:protein binding, transcription factor activity, zinc ion binding;P:biological_process unknown;C:cellular_component unknown;PMFOO.I.C.G.H.G.
14.699.418.1At1g14460838008DNA polymerase-relatedF:nucleoside-triphosphatase activity, DNA binding, DNA-directed DNA polymerase activity, nucleotide binding, ATP binding;P:DNA replication;C:plasma membrane;BOMFAPVO.I.C.G.H.G.
14.599.4126.1At3g51950824358zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing proteinF:RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;PMFOO.I.C.G.H.G.
14.599.452.6At1g10640837607polygalacturonaseF:polygalacturonase activity;P:carbohydrate metabolic process;C:cellular_component unknown;FPBOMAO.I.C.G.H.G.
14.599.417.7At4g02460827997PMS1 (POSTMEIOTIC SEGREGATION 1)Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination.O.I.C.G.H.G.
14.599.415.9At4g21550828240VAL3 (VP1/ABI3-LIKE 3)F:transcription factor activity;P:regulation of transcription, DNA-dependent;C:endomembrane system;PMOO.I.C.G.H.G.
14.499.417.4At3g04960819656-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOBFPAVO.I.C.G.H.G.
14.399.444.8At3g48500824009RNA bindingF:RNA binding;P:unknown;C:plastid chromosome, chloroplast, nucleoid;POVMFBO.I.C.G.H.G.
14.399.444.8At5g57180835824CIA2 (CHLOROPLAST IMPORT APPARATUS 2)Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast.O.I.C.G.H.G.
14.399.421.0At1g09230837443RNA recognition motif (RRM)-containing proteinF:RNA binding, nucleotide binding, nucleic acid binding;P:unknown;C:cellular_component unknown;MPOFBVO.I.C.G.H.G.
14.399.412.0At1g23420838950INO (INNER NO OUTER)Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule.O.I.C.G.H.G.
14.399.49.8At1g03300838627agenet domain-containing proteinF:RNA binding;P:biological_process unknown;C:cellular_component unknown;PMOFBAO.I.C.G.H.G.
14.299.413.2At3g21310821685unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POO.I.C.G.H.G.
14.199.433.3At2g31170817673SYCO ARATHF:cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding;P:cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation;C:mitochondrion, chloroplast;OBMAFPVO.I.C.G.H.G.
14.099.430.9At3g50380824202-F:unknown;P:protein localization;C:mitochondrion;MFPOO.I.C.G.H.G.
13.999.446.9At5g37300833704WSD1Encodes a bifunctional enzyme, wax ester synthase (WS) and diacylglycerol acyltransferase (DGAT). In vitro assay indicated a ratio of 10.9 between its WS and DGAT activities. Both mutant and in vivo expression/analysis in yeast studies indicated a role in wax biosynthesis.O.I.C.G.H.G.
13.999.421.6At5g19310832051homeotic gene regulator, putativeF:helicase activity, DNA binding, ATP binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;MOFBPVAO.I.C.G.H.G.
13.899.4171.1At1g10950837638endomembrane protein 70, putativeF:unknown;P:unknown;C:integral to membrane, Golgi apparatus, membrane;MPOFBO.I.C.G.H.G.
13.899.456.7At3g18850821418LPAT5F:acyltransferase activity;P:metabolic process;C:unknown;MBOFPVO.I.C.G.H.G.
13.899.424.0At5g40150834012peroxidase, putativeF:electron carrier activity, peroxidase activity, heme binding;P:response to oxidative stress;C:endomembrane system;PFOBO.I.C.G.H.G.
13.799.419.1At4g11080826709high mobility group (HMG1/2) family proteinF:transcription factor activity;P:unknown;C:nucleus, chloroplast;MOBFPAVO.I.C.G.H.G.
13.799.418.3At1g26540839194agenet domain-containing proteinF:RNA binding;P:biological_process unknown;C:vacuole;PMOFBVO.I.C.G.H.G.
13.599.440.4At1g78970844237LUP1 (LUPEOL SYNTHASE 1)Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation.O.I.C.G.H.G.
13.599.420.9At5g67200836855leucine-rich repeat transmembrane protein kinase, putativeF:protein binding, protein serine/threonine kinase activity, protein kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:plasma membrane;PMOBFVAO.I.C.G.H.G.
13.499.469.0At1g65295842837unknown proteinF:unknown;P:unknown;C:endomembrane system;PO.I.C.G.H.G.
13.399.429.2At1g69780843314ATHB13Encodes a homeodomain leucine zipper class I (HD-Zip I) protein.O.I.C.G.H.G.
13.399.49.4At1g05550837057unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
13.299.423.5At1g10870837629AGD4 (ARF-GAP domain 4)A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3.O.I.C.G.H.G.
13.099.435.5At5g16750831538TOZ (TORMOZEMBRYO DEFECTIVE)Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development.O.I.C.G.H.G.
13.099.416.0At5g51230835198EMF2 (EMBRYONIC FLOWER 2)Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3.O.I.C.G.H.G.
12.999.343.2At1g06670837177NIH (NUCLEAR DEIH-BOXHELICASE)nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteinsO.I.C.G.H.G.
12.799.324.2At2g31270817684CDT1A (ARABIDOPSIS HOMOLOG OF YEAST CDT1 A)Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. Located in nucleus and chloroplast.O.I.C.G.H.G.
12.799.310.3At1g11730837717galactosyltransferase family proteinF:transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups;P:protein amino acid glycosylation;C:membrane;MPOO.I.C.G.H.G.
12.699.347.9At5g47480834798unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMFBPAVO.I.C.G.H.G.
12.699.35.4At5g06400830528pentatricopeptide (PPR) repeat-containing proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POMFAO.I.C.G.H.G.
12.599.3155.4At3g62400825413unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
12.599.328.2At3g462108237663' exoribonuclease family domain 1-containing proteinF:3'-5'-exoribonuclease activity, RNA binding;P:RNA processing;C:cellular_component unknown;BOMAFPO.I.C.G.H.G.
12.599.327.6At5g10020830865leucine-rich repeat transmembrane protein kinase, putativeF:protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:cytosol, plasma membrane;PMOBFVAO.I.C.G.H.G.
12.599.317.7At2g0381081490718S pre-ribosomal assembly protein gar2-relatedF:molecular_function unknown;P:N-terminal protein myristoylation;C:plasma membrane;BOMFPVAO.I.C.G.H.G.
12.599.311.4At5g18920832010unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PFO.I.C.G.H.G.
12.399.348.2At2g34640818029PTAC12 (PLASTID TRANSCRIPTIONALLY ACTIVE12)Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.O.I.C.G.H.G.
12.399.339.7At5g67110836846ALC (ALCATRAZ)encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce.O.I.C.G.H.G.
12.299.327.4At5g06265830514hyaluronan mediated motility receptor-relatedF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PO.I.C.G.H.G.
12.299.325.5At1g30840839967ATPUP4Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.O.I.C.G.H.G.
12.299.314.7At3g06020819773unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;MOFPVBAO.I.C.G.H.G.
12.299.311.9At3g29370822596unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.



Back to the CoP portal site

Back to the KAGIANA project homepage