CoP: Co-expressed Biological Processes

Microarray experiments to specifically-expressed genes

GSM ID GSM142602

Assay name BD001_ATH1_A6-DAVIE-T14

GSE experiment GSE6149: Targets of the mci genes.

Click Gene ID to show a list of GSM assays in which the gene are specifically expressed.

Std2 GX %ile Std GX Gene ID Repr. ID Gene name Functional description O.I. C.G. H.G. Other DB
91.6 99.9 31.4 At5g43510 834371 - - O.I. C.G. H.G.
59.9 99.8 92.8 At1g29510 839828 SAUR68 (SMALL AUXIN UPREGULATED 68) F:molecular_function unknown;P:response to auxin stimulus;C:unknown;P O.I. C.G. H.G.
37.8 99.8 52.3 At5g39860 833982 PRE1 (PACLOBUTRAZOL RESISTANCE1) F:transcription factor activity, DNA binding;P:regulation of transcription;C:nucleus;P O.I. C.G. H.G.
35.8 99.7 65.0 At2g35190 818086 NPSN11 (NOVEL PLANT SNARE 11) plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate. O.I. C.G. H.G.
33.7 99.7 84.8 At2g07708 815383 unknown protein F:molecular_function unknown;P:biological_process unknown;C:unknown;P O.I. C.G. H.G.
32.2 99.7 45.8 At1g71830 843513 SERK1 (SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE 1) Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. later O.I. C.G. H.G.
32.1 99.7 69.1 At1g02190 839541 CER1 protein, putative F:oxidoreductase activity, iron ion binding, catalytic activity;P:oxidation reduction, fatty acid biosynthetic process;C:endoplasmic reticulum;BOPFMV O.I. C.G. H.G.
31.1 99.7 13.9 At4g14840 827141 unknown protein F:unknown;P:unknown;C:cellular_component unknown;MOFBPAV O.I. C.G. H.G.
30.0 99.7 112.5 At2g07707 815382 hydrogen ion transmembrane transporter/ hydrolase, acting on acid anhydrides, catalyzing transmembrane movement of substances F:hydrogen ion transmembrane transporter activity, hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances;P:ATP synthesis coupled proton transport;C:mitochondrion, vacuole, membrane;PO O.I. C.G. H.G.
29.8 99.7 13.2 At2g21655 816704 unknown protein F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P O.I. C.G. H.G.
29.4 99.7 43.3 At3g46770 823830 transcriptional factor B3 family protein F:transcription factor activity, DNA binding;P:regulation of transcription, DNA-dependent;C:cellular_component unknown;P O.I. C.G. H.G.
25.9 99.7 16.5 At2g40030 818591 NRPD1B Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB1 and the E. coli RNA polymerase beta prime subunit. Required for normal RNA-directed DNA methylation at non-CG methylation sites and transgene silencing. O.I. C.G. H.G.
25.8 99.7 87.7 At5g44630 834491 terpene synthase/cyclase family protein Encodes a sesquiterpene synthase involved in generating all of the group B sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in intrafloral nectaries. O.I. C.G. H.G.
25.0 99.6 47.3 At1g67050 843025 unknown protein F:molecular_function unknown;P:biological_process unknown;C:unknown;OMPFBV O.I. C.G. H.G.
24.7 99.6 25.9 At5g04660 830343 CYP77A4 encodes a protein with cytochrome P450 domain O.I. C.G. H.G.
24.7 99.6 7.5 At2g35870 - - O.I. C.G. H.G.
23.8 99.6 48.2 At5g58440 835957 SNX2a (SORTING NEXIN 2a) F:phosphoinositide binding;P:signal transduction, intracellular signaling cascade;C:cellular_component unknown;MFOPAB O.I. C.G. H.G.
23.0 99.6 24.5 At1g60060 842300 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OPFMB O.I. C.G. H.G.
22.8 99.6 55.5 At5g21150 832241 PAZ domain-containing protein / piwi domain-containing protein F:nucleic acid binding;P:unknown;C:cellular_component unknown;MPFO O.I. C.G. H.G.
22.8 99.6 14.4 At3g61950 825368 basic helix-loop-helix (bHLH) family protein F:transcription factor activity, DNA binding;P:regulation of transcription;C:nucleus;PMFO O.I. C.G. H.G.
22.3 99.6 291.2 At1g72260 843558 THI2.1 (THIONIN 2.1) Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. O.I. C.G. H.G.
22.1 99.6 16.1 At4g16970 827405 ATP binding / kinase/ protein kinase/ protein serine/threonine kinase F:protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MOPFBVA O.I. C.G. H.G.
22.0 99.6 343.6 At1g57660 842142 60S ribosomal protein L21 (RPL21E) F:structural constituent of ribosome;P:translation;C:ribosome, intracellular;MOAFP O.I. C.G. H.G.
21.9 99.6 67.7 At1g73960 843733 TAF2 (TBP-ASSOCIATED FACTOR 2) F:metallopeptidase activity, zinc ion binding;P:unknown;C:cellular_component unknown;MOBFPAV O.I. C.G. H.G.
21.8 99.6 33.6 At2g26110 817151 unknown protein F:molecular_function unknown;P:biological_process unknown;C:unknown;POMFB O.I. C.G. H.G.
20.5 99.6 12.8 At5g12270 831102 oxidoreductase, 2OG-Fe(II) oxygenase family protein F:oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity;P:biological_process unknown;C:cellular_component unknown;POBFM O.I. C.G. H.G.
20.2 99.6 86.2 At2g29210 817470 splicing factor PWI domain-containing protein F:unknown;P:RNA splicing;C:unknown;MOFBPVA O.I. C.G. H.G.
20.1 99.6 122.0 At2g02850 814816 ARPN (PLANTACYANIN) Encodes plantacyanin one of blue copper proteins. Involved in anther development and pollination. Expressed in the transmitting tract of the pistil. O.I. C.G. H.G.
20.1 99.6 54.3 At3g52030 824366 F-box family protein / WD-40 repeat family protein F:molecular_function unknown;P:unknown;C:CUL4 RING ubiquitin ligase complex;MFOPB O.I. C.G. H.G.
20.0 99.6 9.9 At1g05490 837051 chr31 (chromatin remodeling 31) F:helicase activity, DNA binding, ATP binding, nucleic acid binding;P:biological_process unknown;C:unknown;MOBFPVA O.I. C.G. H.G.
19.1 99.6 37.8 At2g42800 818880 AtRLP29 (Receptor Like Protein 29) F:protein binding;P:unknown;C:anchored to membrane, plant-type cell wall;PMOBFA O.I. C.G. H.G.
18.8 99.5 41.8 At1g51460 841571 ABC transporter family protein F:ATPase activity, coupled to transmembrane movement of substances;P:transport;C:membrane;BOMFAPV O.I. C.G. H.G.
18.5 99.5 66.9 At2g45950 819203 ASK20 (ARABIDOPSIS SKP1-LIKE 20) F:ubiquitin-protein ligase activity, protein binding;P:ubiquitin-dependent protein catabolic process;C:SCF ubiquitin ligase complex;MPOFBV O.I. C.G. H.G.
18.5 99.5 19.5 At1g78950 844234 beta-amyrin synthase, putative F:beta-amyrin synthase activity;P:unknown;C:unknown;BPOFMA O.I. C.G. H.G.
18.3 99.5 324.5 At3g57690 824938 AGP23 (ARABINOGALACTAN-PROTEIN 23) Encodes a putative arabinogalactan-protein (AGP23). O.I. C.G. H.G.
18.1 99.5 18.2 At5g35670 833540 iqd33 (IQ-domain 33) F:calmodulin binding;P:biological_process unknown;C:unknown;PBMOF O.I. C.G. H.G.
18.0 99.5 219.1 At3g28500 822480 60S acidic ribosomal protein P2 (RPP2C) F:structural constituent of ribosome;P:translational elongation;C:cytosol, cytosolic ribosome, ribosome, plasma membrane;MFOPAB O.I. C.G. H.G.
17.6 99.5 88.1 At2g15560 816049 - F:unknown;P:response to oxidative stress;C:cellular_component unknown;PMFBO O.I. C.G. H.G.
17.6 99.5 30.5 At2g18220 816337 - F:unknown;P:biological_process unknown;C:cellular_component unknown;MOFPBVA O.I. C.G. H.G.
17.2 99.5 16.1 At5g58782 835993 dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putative F:dehydrodolichyl diphosphate synthase activity;P:dolichol biosynthetic process;C:endomembrane system;OBAFMP O.I. C.G. H.G.
16.9 99.5 19.9 At4g22280 828323 F-box family protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
16.9 99.5 17.2 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA O.I. C.G. H.G.
16.9 99.5 15.4 At4g32970 829434 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOBF O.I. C.G. H.G.
16.8 99.5 7.4 At5g64710 836592 unknown protein F:unknown;P:biological_process unknown;C:unknown;PMBFOA O.I. C.G. H.G.
16.6 99.5 12.1 At1g14690 838034 MAP65-7 (MICROTUBULE-ASSOCIATED PROTEIN 65-7) F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOFPBAV O.I. C.G. H.G.
16.5 99.5 6.1 At4g30870 829211 MUS81 (MMS AND UV SENSITIVE 81) Encodes an Arabidopsis homolog of the endonuclease MSU81. T-DNA insertion lines of AtMSU81 have a deficiency in homologous recombination in somatic cells but only after genotoxic stress. Crosses with a hyperrecombinogenic mutant of the AtRecQ4A helicase resulted in synthetic lethality in the double mutant. O.I. C.G. H.G.
16.3 99.5 26.0 At1g76880 844023 trihelix DNA-binding protein, putative F:transcription factor activity;P:regulation of transcription;C:unknown;OMPFBV O.I. C.G. H.G.
16.3 99.5 14.1 At5g23260 832390 TT16 (TRANSPARENT TESTA16) Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule. O.I. C.G. H.G.
15.8 99.5 125.8 At1g14610 838023 TWN2 (TWIN 2) Required for proper proliferation of basal cells. O.I. C.G. H.G.
15.8 99.5 15.1 At1g12460 837803 leucine-rich repeat transmembrane protein kinase, putative F:protein serine/threonine kinase activity, kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:plasma membrane;MPOBFVA O.I. C.G. H.G.
15.3 99.4 4.1 At5g48200 834873 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
14.9 99.4 49.0 At1g06230 837133 GTE4 (GLOBAL TRANSCRIPTION FACTOR GROUP E 4) This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation. O.I. C.G. H.G.
14.9 99.4 17.3 At2g28870 817436 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
14.7 99.4 141.9 At2g07698 815374 ATP synthase alpha chain, mitochondrial, putative F:hydrogen ion transporting ATP synthase activity, rotational mechanism, poly(U) binding;P:proton transport, ATP metabolic process, ATP synthesis coupled proton transport;C:in 7 components;BOPMAF O.I. C.G. H.G.
14.6 99.4 22.9 At4g21430 827895 B160 F:protein binding, transcription factor activity, zinc ion binding;P:biological_process unknown;C:cellular_component unknown;PMFO O.I. C.G. H.G.
14.6 99.4 18.1 At1g14460 838008 DNA polymerase-related F:nucleoside-triphosphatase activity, DNA binding, DNA-directed DNA polymerase activity, nucleotide binding, ATP binding;P:DNA replication;C:plasma membrane;BOMFAPV O.I. C.G. H.G.
14.5 99.4 126.1 At3g51950 824358 zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein F:RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;PMFO O.I. C.G. H.G.
14.5 99.4 52.6 At1g10640 837607 polygalacturonase F:polygalacturonase activity;P:carbohydrate metabolic process;C:cellular_component unknown;FPBOMA O.I. C.G. H.G.
14.5 99.4 17.7 At4g02460 827997 PMS1 (POSTMEIOTIC SEGREGATION 1) Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination. O.I. C.G. H.G.
14.5 99.4 15.9 At4g21550 828240 VAL3 (VP1/ABI3-LIKE 3) F:transcription factor activity;P:regulation of transcription, DNA-dependent;C:endomembrane system;PMO O.I. C.G. H.G.
14.4 99.4 17.4 At3g04960 819656 - F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOBFPAV O.I. C.G. H.G.
14.3 99.4 44.8 At3g48500 824009 RNA binding F:RNA binding;P:unknown;C:plastid chromosome, chloroplast, nucleoid;POVMFB O.I. C.G. H.G.
14.3 99.4 44.8 At5g57180 835824 CIA2 (CHLOROPLAST IMPORT APPARATUS 2) Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. O.I. C.G. H.G.
14.3 99.4 21.0 At1g09230 837443 RNA recognition motif (RRM)-containing protein F:RNA binding, nucleotide binding, nucleic acid binding;P:unknown;C:cellular_component unknown;MPOFBV O.I. C.G. H.G.
14.3 99.4 12.0 At1g23420 838950 INO (INNER NO OUTER) Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule. O.I. C.G. H.G.
14.3 99.4 9.8 At1g03300 838627 agenet domain-containing protein F:RNA binding;P:biological_process unknown;C:cellular_component unknown;PMOFBA O.I. C.G. H.G.
14.2 99.4 13.2 At3g21310 821685 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO O.I. C.G. H.G.
14.1 99.4 33.3 At2g31170 817673 SYCO ARATH F:cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding;P:cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation;C:mitochondrion, chloroplast;OBMAFPV O.I. C.G. H.G.
14.0 99.4 30.9 At3g50380 824202 - F:unknown;P:protein localization;C:mitochondrion;MFPO O.I. C.G. H.G.
13.9 99.4 46.9 At5g37300 833704 WSD1 Encodes a bifunctional enzyme, wax ester synthase (WS) and diacylglycerol acyltransferase (DGAT). In vitro assay indicated a ratio of 10.9 between its WS and DGAT activities. Both mutant and in vivo expression/analysis in yeast studies indicated a role in wax biosynthesis. O.I. C.G. H.G.
13.9 99.4 21.6 At5g19310 832051 homeotic gene regulator, putative F:helicase activity, DNA binding, ATP binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;MOFBPVA O.I. C.G. H.G.
13.8 99.4 171.1 At1g10950 837638 endomembrane protein 70, putative F:unknown;P:unknown;C:integral to membrane, Golgi apparatus, membrane;MPOFB O.I. C.G. H.G.
13.8 99.4 56.7 At3g18850 821418 LPAT5 F:acyltransferase activity;P:metabolic process;C:unknown;MBOFPV O.I. C.G. H.G.
13.8 99.4 24.0 At5g40150 834012 peroxidase, putative F:electron carrier activity, peroxidase activity, heme binding;P:response to oxidative stress;C:endomembrane system;PFOB O.I. C.G. H.G.
13.7 99.4 19.1 At4g11080 826709 high mobility group (HMG1/2) family protein F:transcription factor activity;P:unknown;C:nucleus, chloroplast;MOBFPAV O.I. C.G. H.G.
13.7 99.4 18.3 At1g26540 839194 agenet domain-containing protein F:RNA binding;P:biological_process unknown;C:vacuole;PMOFBV O.I. C.G. H.G.
13.5 99.4 40.4 At1g78970 844237 LUP1 (LUPEOL SYNTHASE 1) Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. O.I. C.G. H.G.
13.5 99.4 20.9 At5g67200 836855 leucine-rich repeat transmembrane protein kinase, putative F:protein binding, protein serine/threonine kinase activity, protein kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:plasma membrane;PMOBFVA O.I. C.G. H.G.
13.4 99.4 69.0 At1g65295 842837 unknown protein F:unknown;P:unknown;C:endomembrane system;P O.I. C.G. H.G.
13.3 99.4 29.2 At1g69780 843314 ATHB13 Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. O.I. C.G. H.G.
13.3 99.4 9.4 At1g05550 837057 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
13.2 99.4 23.5 At1g10870 837629 AGD4 (ARF-GAP domain 4) A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3. O.I. C.G. H.G.
13.0 99.4 35.5 At5g16750 831538 TOZ (TORMOZEMBRYO DEFECTIVE) Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. O.I. C.G. H.G.
13.0 99.4 16.0 At5g51230 835198 EMF2 (EMBRYONIC FLOWER 2) Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3. O.I. C.G. H.G.
12.9 99.3 43.2 At1g06670 837177 NIH (NUCLEAR DEIH-BOXHELICASE) nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins O.I. C.G. H.G.
12.7 99.3 24.2 At2g31270 817684 CDT1A (ARABIDOPSIS HOMOLOG OF YEAST CDT1 A) Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. Located in nucleus and chloroplast. O.I. C.G. H.G.
12.7 99.3 10.3 At1g11730 837717 galactosyltransferase family protein F:transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups;P:protein amino acid glycosylation;C:membrane;MPO O.I. C.G. H.G.
12.6 99.3 47.9 At5g47480 834798 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMFBPAV O.I. C.G. H.G.
12.6 99.3 5.4 At5g06400 830528 pentatricopeptide (PPR) repeat-containing protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POMFA O.I. C.G. H.G.
12.5 99.3 155.4 At3g62400 825413 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
12.5 99.3 28.2 At3g46210 823766 3' exoribonuclease family domain 1-containing protein F:3'-5'-exoribonuclease activity, RNA binding;P:RNA processing;C:cellular_component unknown;BOMAFP O.I. C.G. H.G.
12.5 99.3 27.6 At5g10020 830865 leucine-rich repeat transmembrane protein kinase, putative F:protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:cytosol, plasma membrane;PMOBFVA O.I. C.G. H.G.
12.5 99.3 17.7 At2g03810 814907 18S pre-ribosomal assembly protein gar2-related F:molecular_function unknown;P:N-terminal protein myristoylation;C:plasma membrane;BOMFPVA O.I. C.G. H.G.
12.5 99.3 11.4 At5g18920 832010 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PF O.I. C.G. H.G.
12.3 99.3 48.2 At2g34640 818029 PTAC12 (PLASTID TRANSCRIPTIONALLY ACTIVE12) Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. O.I. C.G. H.G.
12.3 99.3 39.7 At5g67110 836846 ALC (ALCATRAZ) encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce. O.I. C.G. H.G.
12.2 99.3 27.4 At5g06265 830514 hyaluronan mediated motility receptor-related F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P O.I. C.G. H.G.
12.2 99.3 25.5 At1g30840 839967 ATPUP4 Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. O.I. C.G. H.G.
12.2 99.3 14.7 At3g06020 819773 unknown protein F:molecular_function unknown;P:biological_process unknown;C:unknown;MOFPVBA O.I. C.G. H.G.
12.2 99.3 11.9 At3g29370 822596 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.

Std2 GX	%ile	Std GX	Gene ID	Repr. ID	Gene name	Functional description	O.I.	C.G.	H.G.
91.6	99.9	31.4	At5g43510	834371	-	-	O.I.	C.G.	H.G.
59.9	99.8	92.8	At1g29510	839828	SAUR68 (SMALL AUXIN UPREGULATED 68)	F:molecular_function unknown;P:response to auxin stimulus;C:unknown;P	O.I.	C.G.	H.G.
37.8	99.8	52.3	At5g39860	833982	PRE1 (PACLOBUTRAZOL RESISTANCE1)	F:transcription factor activity, DNA binding;P:regulation of transcription;C:nucleus;P	O.I.	C.G.	H.G.
35.8	99.7	65.0	At2g35190	818086	NPSN11 (NOVEL PLANT SNARE 11)	plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate.	O.I.	C.G.	H.G.
33.7	99.7	84.8	At2g07708	815383	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:unknown;P	O.I.	C.G.	H.G.
32.2	99.7	45.8	At1g71830	843513	SERK1 (SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE 1)	Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. later	O.I.	C.G.	H.G.
32.1	99.7	69.1	At1g02190	839541	CER1 protein, putative	F:oxidoreductase activity, iron ion binding, catalytic activity;P:oxidation reduction, fatty acid biosynthetic process;C:endoplasmic reticulum;BOPFMV	O.I.	C.G.	H.G.
31.1	99.7	13.9	At4g14840	827141	unknown protein	F:unknown;P:unknown;C:cellular_component unknown;MOFBPAV	O.I.	C.G.	H.G.
30.0	99.7	112.5	At2g07707	815382	hydrogen ion transmembrane transporter/ hydrolase, acting on acid anhydrides, catalyzing transmembrane movement of substances	F:hydrogen ion transmembrane transporter activity, hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances;P:ATP synthesis coupled proton transport;C:mitochondrion, vacuole, membrane;PO	O.I.	C.G.	H.G.
29.8	99.7	13.2	At2g21655	816704	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P	O.I.	C.G.	H.G.
29.4	99.7	43.3	At3g46770	823830	transcriptional factor B3 family protein	F:transcription factor activity, DNA binding;P:regulation of transcription, DNA-dependent;C:cellular_component unknown;P	O.I.	C.G.	H.G.
25.9	99.7	16.5	At2g40030	818591	NRPD1B	Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB1 and the E. coli RNA polymerase beta prime subunit. Required for normal RNA-directed DNA methylation at non-CG methylation sites and transgene silencing.	O.I.	C.G.	H.G.
25.8	99.7	87.7	At5g44630	834491	terpene synthase/cyclase family protein	Encodes a sesquiterpene synthase involved in generating all of the group B sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in intrafloral nectaries.	O.I.	C.G.	H.G.
25.0	99.6	47.3	At1g67050	843025	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:unknown;OMPFBV	O.I.	C.G.	H.G.
24.7	99.6	25.9	At5g04660	830343	CYP77A4	encodes a protein with cytochrome P450 domain	O.I.	C.G.	H.G.
24.7	99.6	7.5	At2g35870		-	-	O.I.	C.G.	H.G.
23.8	99.6	48.2	At5g58440	835957	SNX2a (SORTING NEXIN 2a)	F:phosphoinositide binding;P:signal transduction, intracellular signaling cascade;C:cellular_component unknown;MFOPAB	O.I.	C.G.	H.G.
23.0	99.6	24.5	At1g60060	842300	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OPFMB	O.I.	C.G.	H.G.
22.8	99.6	55.5	At5g21150	832241	PAZ domain-containing protein / piwi domain-containing protein	F:nucleic acid binding;P:unknown;C:cellular_component unknown;MPFO	O.I.	C.G.	H.G.
22.8	99.6	14.4	At3g61950	825368	basic helix-loop-helix (bHLH) family protein	F:transcription factor activity, DNA binding;P:regulation of transcription;C:nucleus;PMFO	O.I.	C.G.	H.G.
22.3	99.6	291.2	At1g72260	843558	THI2.1 (THIONIN 2.1)	Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660.	O.I.	C.G.	H.G.
22.1	99.6	16.1	At4g16970	827405	ATP binding / kinase/ protein kinase/ protein serine/threonine kinase	F:protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MOPFBVA	O.I.	C.G.	H.G.
22.0	99.6	343.6	At1g57660	842142	60S ribosomal protein L21 (RPL21E)	F:structural constituent of ribosome;P:translation;C:ribosome, intracellular;MOAFP	O.I.	C.G.	H.G.
21.9	99.6	67.7	At1g73960	843733	TAF2 (TBP-ASSOCIATED FACTOR 2)	F:metallopeptidase activity, zinc ion binding;P:unknown;C:cellular_component unknown;MOBFPAV	O.I.	C.G.	H.G.
21.8	99.6	33.6	At2g26110	817151	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:unknown;POMFB	O.I.	C.G.	H.G.
20.5	99.6	12.8	At5g12270	831102	oxidoreductase, 2OG-Fe(II) oxygenase family protein	F:oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity;P:biological_process unknown;C:cellular_component unknown;POBFM	O.I.	C.G.	H.G.
20.2	99.6	86.2	At2g29210	817470	splicing factor PWI domain-containing protein	F:unknown;P:RNA splicing;C:unknown;MOFBPVA	O.I.	C.G.	H.G.
20.1	99.6	122.0	At2g02850	814816	ARPN (PLANTACYANIN)	Encodes plantacyanin one of blue copper proteins. Involved in anther development and pollination. Expressed in the transmitting tract of the pistil.	O.I.	C.G.	H.G.
20.1	99.6	54.3	At3g52030	824366	F-box family protein / WD-40 repeat family protein	F:molecular_function unknown;P:unknown;C:CUL4 RING ubiquitin ligase complex;MFOPB	O.I.	C.G.	H.G.
20.0	99.6	9.9	At1g05490	837051	chr31 (chromatin remodeling 31)	F:helicase activity, DNA binding, ATP binding, nucleic acid binding;P:biological_process unknown;C:unknown;MOBFPVA	O.I.	C.G.	H.G.
19.1	99.6	37.8	At2g42800	818880	AtRLP29 (Receptor Like Protein 29)	F:protein binding;P:unknown;C:anchored to membrane, plant-type cell wall;PMOBFA	O.I.	C.G.	H.G.
18.8	99.5	41.8	At1g51460	841571	ABC transporter family protein	F:ATPase activity, coupled to transmembrane movement of substances;P:transport;C:membrane;BOMFAPV	O.I.	C.G.	H.G.
18.5	99.5	66.9	At2g45950	819203	ASK20 (ARABIDOPSIS SKP1-LIKE 20)	F:ubiquitin-protein ligase activity, protein binding;P:ubiquitin-dependent protein catabolic process;C:SCF ubiquitin ligase complex;MPOFBV	O.I.	C.G.	H.G.
18.5	99.5	19.5	At1g78950	844234	beta-amyrin synthase, putative	F:beta-amyrin synthase activity;P:unknown;C:unknown;BPOFMA	O.I.	C.G.	H.G.
18.3	99.5	324.5	At3g57690	824938	AGP23 (ARABINOGALACTAN-PROTEIN 23)	Encodes a putative arabinogalactan-protein (AGP23).	O.I.	C.G.	H.G.
18.1	99.5	18.2	At5g35670	833540	iqd33 (IQ-domain 33)	F:calmodulin binding;P:biological_process unknown;C:unknown;PBMOF	O.I.	C.G.	H.G.
18.0	99.5	219.1	At3g28500	822480	60S acidic ribosomal protein P2 (RPP2C)	F:structural constituent of ribosome;P:translational elongation;C:cytosol, cytosolic ribosome, ribosome, plasma membrane;MFOPAB	O.I.	C.G.	H.G.
17.6	99.5	88.1	At2g15560	816049	-	F:unknown;P:response to oxidative stress;C:cellular_component unknown;PMFBO	O.I.	C.G.	H.G.
17.6	99.5	30.5	At2g18220	816337	-	F:unknown;P:biological_process unknown;C:cellular_component unknown;MOFPBVA	O.I.	C.G.	H.G.
17.2	99.5	16.1	At5g58782	835993	dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putative	F:dehydrodolichyl diphosphate synthase activity;P:dolichol biosynthetic process;C:endomembrane system;OBAFMP	O.I.	C.G.	H.G.
16.9	99.5	19.9	At4g22280	828323	F-box family protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
16.9	99.5	17.2	At5g08210	830717	MIR834a	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA	O.I.	C.G.	H.G.
16.9	99.5	15.4	At4g32970	829434	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOBF	O.I.	C.G.	H.G.
16.8	99.5	7.4	At5g64710	836592	unknown protein	F:unknown;P:biological_process unknown;C:unknown;PMBFOA	O.I.	C.G.	H.G.
16.6	99.5	12.1	At1g14690	838034	MAP65-7 (MICROTUBULE-ASSOCIATED PROTEIN 65-7)	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOFPBAV	O.I.	C.G.	H.G.
16.5	99.5	6.1	At4g30870	829211	MUS81 (MMS AND UV SENSITIVE 81)	Encodes an Arabidopsis homolog of the endonuclease MSU81. T-DNA insertion lines of AtMSU81 have a deficiency in homologous recombination in somatic cells but only after genotoxic stress. Crosses with a hyperrecombinogenic mutant of the AtRecQ4A helicase resulted in synthetic lethality in the double mutant.	O.I.	C.G.	H.G.
16.3	99.5	26.0	At1g76880	844023	trihelix DNA-binding protein, putative	F:transcription factor activity;P:regulation of transcription;C:unknown;OMPFBV	O.I.	C.G.	H.G.
16.3	99.5	14.1	At5g23260	832390	TT16 (TRANSPARENT TESTA16)	Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule.	O.I.	C.G.	H.G.
15.8	99.5	125.8	At1g14610	838023	TWN2 (TWIN 2)	Required for proper proliferation of basal cells.	O.I.	C.G.	H.G.
15.8	99.5	15.1	At1g12460	837803	leucine-rich repeat transmembrane protein kinase, putative	F:protein serine/threonine kinase activity, kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:plasma membrane;MPOBFVA	O.I.	C.G.	H.G.
15.3	99.4	4.1	At5g48200	834873	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
14.9	99.4	49.0	At1g06230	837133	GTE4 (GLOBAL TRANSCRIPTION FACTOR GROUP E 4)	This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation.	O.I.	C.G.	H.G.
14.9	99.4	17.3	At2g28870	817436	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
14.7	99.4	141.9	At2g07698	815374	ATP synthase alpha chain, mitochondrial, putative	F:hydrogen ion transporting ATP synthase activity, rotational mechanism, poly(U) binding;P:proton transport, ATP metabolic process, ATP synthesis coupled proton transport;C:in 7 components;BOPMAF	O.I.	C.G.	H.G.
14.6	99.4	22.9	At4g21430	827895	B160	F:protein binding, transcription factor activity, zinc ion binding;P:biological_process unknown;C:cellular_component unknown;PMFO	O.I.	C.G.	H.G.
14.6	99.4	18.1	At1g14460	838008	DNA polymerase-related	F:nucleoside-triphosphatase activity, DNA binding, DNA-directed DNA polymerase activity, nucleotide binding, ATP binding;P:DNA replication;C:plasma membrane;BOMFAPV	O.I.	C.G.	H.G.
14.5	99.4	126.1	At3g51950	824358	zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein	F:RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;PMFO	O.I.	C.G.	H.G.
14.5	99.4	52.6	At1g10640	837607	polygalacturonase	F:polygalacturonase activity;P:carbohydrate metabolic process;C:cellular_component unknown;FPBOMA	O.I.	C.G.	H.G.
14.5	99.4	17.7	At4g02460	827997	PMS1 (POSTMEIOTIC SEGREGATION 1)	Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination.	O.I.	C.G.	H.G.
14.5	99.4	15.9	At4g21550	828240	VAL3 (VP1/ABI3-LIKE 3)	F:transcription factor activity;P:regulation of transcription, DNA-dependent;C:endomembrane system;PMO	O.I.	C.G.	H.G.
14.4	99.4	17.4	At3g04960	819656	-	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOBFPAV	O.I.	C.G.	H.G.
14.3	99.4	44.8	At3g48500	824009	RNA binding	F:RNA binding;P:unknown;C:plastid chromosome, chloroplast, nucleoid;POVMFB	O.I.	C.G.	H.G.
14.3	99.4	44.8	At5g57180	835824	CIA2 (CHLOROPLAST IMPORT APPARATUS 2)	Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast.	O.I.	C.G.	H.G.
14.3	99.4	21.0	At1g09230	837443	RNA recognition motif (RRM)-containing protein	F:RNA binding, nucleotide binding, nucleic acid binding;P:unknown;C:cellular_component unknown;MPOFBV	O.I.	C.G.	H.G.
14.3	99.4	12.0	At1g23420	838950	INO (INNER NO OUTER)	Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule.	O.I.	C.G.	H.G.
14.3	99.4	9.8	At1g03300	838627	agenet domain-containing protein	F:RNA binding;P:biological_process unknown;C:cellular_component unknown;PMOFBA	O.I.	C.G.	H.G.
14.2	99.4	13.2	At3g21310	821685	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO	O.I.	C.G.	H.G.
14.1	99.4	33.3	At2g31170	817673	SYCO ARATH	F:cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding;P:cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation;C:mitochondrion, chloroplast;OBMAFPV	O.I.	C.G.	H.G.
14.0	99.4	30.9	At3g50380	824202	-	F:unknown;P:protein localization;C:mitochondrion;MFPO	O.I.	C.G.	H.G.
13.9	99.4	46.9	At5g37300	833704	WSD1	Encodes a bifunctional enzyme, wax ester synthase (WS) and diacylglycerol acyltransferase (DGAT). In vitro assay indicated a ratio of 10.9 between its WS and DGAT activities. Both mutant and in vivo expression/analysis in yeast studies indicated a role in wax biosynthesis.	O.I.	C.G.	H.G.
13.9	99.4	21.6	At5g19310	832051	homeotic gene regulator, putative	F:helicase activity, DNA binding, ATP binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;MOFBPVA	O.I.	C.G.	H.G.
13.8	99.4	171.1	At1g10950	837638	endomembrane protein 70, putative	F:unknown;P:unknown;C:integral to membrane, Golgi apparatus, membrane;MPOFB	O.I.	C.G.	H.G.
13.8	99.4	56.7	At3g18850	821418	LPAT5	F:acyltransferase activity;P:metabolic process;C:unknown;MBOFPV	O.I.	C.G.	H.G.
13.8	99.4	24.0	At5g40150	834012	peroxidase, putative	F:electron carrier activity, peroxidase activity, heme binding;P:response to oxidative stress;C:endomembrane system;PFOB	O.I.	C.G.	H.G.
13.7	99.4	19.1	At4g11080	826709	high mobility group (HMG1/2) family protein	F:transcription factor activity;P:unknown;C:nucleus, chloroplast;MOBFPAV	O.I.	C.G.	H.G.
13.7	99.4	18.3	At1g26540	839194	agenet domain-containing protein	F:RNA binding;P:biological_process unknown;C:vacuole;PMOFBV	O.I.	C.G.	H.G.
13.5	99.4	40.4	At1g78970	844237	LUP1 (LUPEOL SYNTHASE 1)	Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation.	O.I.	C.G.	H.G.
13.5	99.4	20.9	At5g67200	836855	leucine-rich repeat transmembrane protein kinase, putative	F:protein binding, protein serine/threonine kinase activity, protein kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:plasma membrane;PMOBFVA	O.I.	C.G.	H.G.
13.4	99.4	69.0	At1g65295	842837	unknown protein	F:unknown;P:unknown;C:endomembrane system;P	O.I.	C.G.	H.G.
13.3	99.4	29.2	At1g69780	843314	ATHB13	Encodes a homeodomain leucine zipper class I (HD-Zip I) protein.	O.I.	C.G.	H.G.
13.3	99.4	9.4	At1g05550	837057	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
13.2	99.4	23.5	At1g10870	837629	AGD4 (ARF-GAP domain 4)	A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3.	O.I.	C.G.	H.G.
13.0	99.4	35.5	At5g16750	831538	TOZ (TORMOZEMBRYO DEFECTIVE)	Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development.	O.I.	C.G.	H.G.
13.0	99.4	16.0	At5g51230	835198	EMF2 (EMBRYONIC FLOWER 2)	Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3.	O.I.	C.G.	H.G.
12.9	99.3	43.2	At1g06670	837177	NIH (NUCLEAR DEIH-BOXHELICASE)	nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins	O.I.	C.G.	H.G.
12.7	99.3	24.2	At2g31270	817684	CDT1A (ARABIDOPSIS HOMOLOG OF YEAST CDT1 A)	Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. Located in nucleus and chloroplast.	O.I.	C.G.	H.G.
12.7	99.3	10.3	At1g11730	837717	galactosyltransferase family protein	F:transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups;P:protein amino acid glycosylation;C:membrane;MPO	O.I.	C.G.	H.G.
12.6	99.3	47.9	At5g47480	834798	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMFBPAV	O.I.	C.G.	H.G.
12.6	99.3	5.4	At5g06400	830528	pentatricopeptide (PPR) repeat-containing protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POMFA	O.I.	C.G.	H.G.
12.5	99.3	155.4	At3g62400	825413	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
12.5	99.3	28.2	At3g46210	823766	3' exoribonuclease family domain 1-containing protein	F:3'-5'-exoribonuclease activity, RNA binding;P:RNA processing;C:cellular_component unknown;BOMAFP	O.I.	C.G.	H.G.
12.5	99.3	27.6	At5g10020	830865	leucine-rich repeat transmembrane protein kinase, putative	F:protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding;P:transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation;C:cytosol, plasma membrane;PMOBFVA	O.I.	C.G.	H.G.
12.5	99.3	17.7	At2g03810	814907	18S pre-ribosomal assembly protein gar2-related	F:molecular_function unknown;P:N-terminal protein myristoylation;C:plasma membrane;BOMFPVA	O.I.	C.G.	H.G.
12.5	99.3	11.4	At5g18920	832010	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PF	O.I.	C.G.	H.G.
12.3	99.3	48.2	At2g34640	818029	PTAC12 (PLASTID TRANSCRIPTIONALLY ACTIVE12)	Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.	O.I.	C.G.	H.G.
12.3	99.3	39.7	At5g67110	836846	ALC (ALCATRAZ)	encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce.	O.I.	C.G.	H.G.
12.2	99.3	27.4	At5g06265	830514	hyaluronan mediated motility receptor-related	F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P	O.I.	C.G.	H.G.
12.2	99.3	25.5	At1g30840	839967	ATPUP4	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.	O.I.	C.G.	H.G.
12.2	99.3	14.7	At3g06020	819773	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:unknown;MOFPVBA	O.I.	C.G.	H.G.
12.2	99.3	11.9	At3g29370	822596	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.

Back to the CoP portal site

Back to the KAGIANA project homepage

GSM ID	GSM142602
Assay name	BD001_ATH1_A6-DAVIE-T14
GSE experiment	GSE6149: Targets of the mci genes.

Microarray experiments to specifically-expressed genes

GSM ID GSM142602 Assay name BD001_ATH1_A6-DAVIE-T14 GSE experiment GSE6149: Targets of the mci genes.

GSM ID GSM142602

Assay name BD001_ATH1_A6-DAVIE-T14

GSE experiment GSE6149: Targets of the mci genes.