Microarray experiments to specifically-expressed genes

GSM ID -
Assay name E-MEXP-509-raw-cel-829148808
GSE experiment -

Click Gene ID to show a list of GSM assays in which the gene are specifically expressed.

Std2 GX %ile Std GX Gene ID Repr. ID Gene name Functional description O.I. C.G. H.G. Other DB
186.7100.013.2At2g068903768157transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
173.9100.075.6At5g60400836162unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
170.6100.013.7At1g32680840162transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
164.099.9274.7At1g24822839086unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
163.999.922.6At5g26970832755unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknownO.I.C.G.H.G.
159.399.933.0At2g13660815851unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
137.199.9158.5At1g356123766952transposable element genepseudogene of Ulp1 protease family proteinO.I.C.G.H.G.
124.499.927.2At2g02550814785nucleaseF:nuclease activity;P:DNA repair;C:unknown;MFOPAO.I.C.G.H.G.
122.799.95.8At2g30925817643unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PO.I.C.G.H.G.
116.499.9207.7At1g53885841826senescence-associated protein-relatedF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
114.099.934.1At4g33610829501glycine-rich proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;BMPOVFO.I.C.G.H.G.
105.099.987.5At1g16400838210CYP79F2Encodes cytochrome P450 CYP79F2.O.I.C.G.H.G.
101.799.919.3At3g28120822436unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane systemO.I.C.G.H.G.
99.699.971.1At2g28820--O.I.C.G.H.G.
97.899.978.3At4g33310829467unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
96.599.9124.2At2g42190818819unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOFPVBAO.I.C.G.H.G.
92.999.9177.6At5g49640835026unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
92.099.931.3At3g02390820514unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
88.599.928.7At1g29610839838-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
87.599.933.4At5g17950831662unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
86.299.944.5At2g25990817140unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknownO.I.C.G.H.G.
84.499.941.6At2g01310814659unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
83.599.95.1At2g108403768125transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
80.799.911.0At4g16930827401disease resistance protein (TIR-NBS-LRR class), putativeF:transmembrane receptor activity;P:signal transduction, defense response, innate immune response;C:intrinsic to membrane;PO.I.C.G.H.G.
77.399.964.0At5g07100830601WRKY26Encodes WRKY DNA-binding protein 26 (WRKY26).O.I.C.G.H.G.
76.999.940.6At4g15690827246glutaredoxin family proteinF:electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity;P:cell redox homeostasis;C:endomembrane system;PMFOBO.I.C.G.H.G.
74.899.974.6At4g31030829230unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
73.499.9185.9At2g18440816358GUT15 (GENE WITH UNSTABLE TRANSCRIPT 15)Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product.O.I.C.G.H.G.
73.399.938.1At5g35480833512unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
73.399.913.0At1g64410842750transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
72.999.937.5At1g49245841348-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PMO.I.C.G.H.G.
72.999.932.9At2g02520814782-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
71.999.922.8At4g03440827920ankyrin repeat family proteinF:protein binding;P:unknown;C:unknown;MOPBFVAO.I.C.G.H.G.
70.999.984.7At3g204703768804GRP5 (GLYCINE-RICH PROTEIN 5)encodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers.O.I.C.G.H.G.
70.999.929.9At1g55990842050glycine-rich proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;BOPMO.I.C.G.H.G.
70.799.96.5At2g23920816924unknown proteinF:unknown;P:N-terminal protein myristoylation;C:unknown;PO.I.C.G.H.G.
70.599.925.9At1g33000840195transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
70.499.915.6At5g65610836687unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
69.699.921.1At5g57730835880unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
68.699.922.8At4g02910828141unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
68.099.945.0At5g12450831120-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
67.299.88.9At5g57310835836unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
65.799.825.9At3g53770824544late embryogenesis abundant protein-related / LEA protein-relatedF:molecular_function unknown;P:response to stress;C:unknown;PO.I.C.G.H.G.
64.999.83.6At5g49590835021unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
64.799.86.0At1g39430840698transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
63.299.813.2At2g05500815099unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
63.199.822.3At1g59535842244unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
62.599.837.5At3g61900825363auxin-responsive family proteinF:molecular_function unknown;P:response to auxin stimulus;C:cellular_component unknown;POO.I.C.G.H.G.
61.999.832.9At5g08210830717MIR834aEncodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAAO.I.C.G.H.G.
61.799.819.2At1g19060838488unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
61.599.872.0At5g64180836539unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFBO.I.C.G.H.G.
60.999.815.2At5g63340836454unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
59.099.812.1At2g14160815902nucleic acid binding / nucleotide bindingF:nucleotide binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;PBO.I.C.G.H.G.
58.899.89.5At4g03680825668transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
56.699.819.4At2g05950815148transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
56.399.818.6At1g32570840151unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
55.299.818.3At5g39620833958AtRABG1 (Arabidopsis Rab GTPase homolog G1)F:GTP binding;P:protein transport, small GTPase mediated signal transduction;C:unknown;MOFPBVAO.I.C.G.H.G.
54.999.810.1At5g35510833515unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
54.299.852.6At1g12320837786unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
53.799.827.1At2g37610818338unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
53.199.876.0At5g3980083397660S ribosomal protein-relatedF:molecular_function unknown;P:biological_process unknown;C:unknown;MFPOO.I.C.G.H.G.
52.799.89.6At5g25130832584CYP71B12putative cytochrome P450O.I.C.G.H.G.
52.699.881.9At2g16365816133F-box family proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POO.I.C.G.H.G.
52.699.810.2At2g19510816470LBD8 (LOB DOMAIN-CONTAINING PROTEIN 8)F:unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
52.399.820.5At1g67635843087-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
52.099.8109.1At3g11230820293yippee family proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;MFPOO.I.C.G.H.G.
51.899.8392.3At4g37300829885MEE59 (maternal effect embryo arrest 59)F:molecular_function unknown;P:embryonic development ending in seed dormancy;C:cellular_component unknown;PO.I.C.G.H.G.
50.199.815.6At3g04270819582unknown proteinF:unknown;P:unknown;C:cellular_component unknown;PO.I.C.G.H.G.
49.299.824.2At2g05870815139transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
47.799.848.2At4g13195826934CLE44 (CLAVATA3/ESR-RELATED 44)Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770).O.I.C.G.H.G.
47.599.813.7At2g20070816526-F:molecular_function unknown;P:unknown;C:endomembrane system;PO.I.C.G.H.G.
47.099.8101.5At3g14340820654unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
46.899.8149.6At2g35840818157sucrose-phosphatase 1 (SPP1)F:phosphatase activity, magnesium ion binding, sucrose-phosphatase activity, catalytic activity;P:response to cadmium ion, sucrose biosynthetic process;C:nucleus, cytoplasm;BPOO.I.C.G.H.G.
46.699.827.9At3g05080819670unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
46.399.8153.7At3g29210822575transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
46.399.846.0At4g39235830079unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
46.399.815.1At1g50930841515unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMPFVBO.I.C.G.H.G.
46.199.819.8At2g02340814765AtPP2-B8 (Phloem protein 2-B8)F:carbohydrate binding;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
45.799.863.3At1g13700837931glucosamine/galactosamine-6-phosphate isomerase family proteinF:6-phosphogluconolactonase activity, catalytic activity;P:pentose-phosphate shunt, carbohydrate metabolic process;C:cellular_component unknown;BOFMPO.I.C.G.H.G.
43.499.818.9At3g47910823946ubiquitin thiolesterase/ zinc ion bindingF:ubiquitin thiolesterase activity, zinc ion binding;P:ubiquitin-dependent protein catabolic process;C:intracellular;MOFPBAVO.I.C.G.H.G.
43.199.824.0At1g23610838971unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
42.899.822.1At1g10690837612unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
42.499.884.3At2g28720817421histone H2B, putativeF:DNA binding;P:nucleosome assembly;C:nucleus, nucleosome;MOPFBO.I.C.G.H.G.
42.299.834.0At2g23430816875ICK1Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1.O.I.C.G.H.G.
42.099.822.9At3g16750820927unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMBFPAVO.I.C.G.H.G.
41.799.811.4At5g42110834216unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PO.I.C.G.H.G.
41.699.827.6At5g03210831903unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PO.I.C.G.H.G.
41.599.820.3At1g28135839707unknown proteinF:molecular_function unknown;P:biological_process unknown;C:chloroplast;PO.I.C.G.H.G.
41.599.85.8At1g77910844126unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
40.799.828.5At5g409203771388-F:unknown;P:unknown;C:unknownO.I.C.G.H.G.
40.599.813.6At5g53810835462O-methyltransferase, putativeF:methyltransferase activity, protein dimerization activity, O-methyltransferase activity;P:unknown;C:cytosol;PBFOMO.I.C.G.H.G.
40.399.851.0At1g54430841885transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
40.099.813.7At2g06020815156myb family transcription factorF:transcription factor activity, DNA binding;P:regulation of transcription;C:unknown;POO.I.C.G.H.G.
38.499.89.4At1g31260840014ZIP10 (ZINC TRANSPORTER 10 PRECURSOR)member of Fe(II) transporter isolog familyO.I.C.G.H.G.
38.499.86.6At1g621603767608serine-type endopeptidase inhibitorF:serine-type endopeptidase inhibitor activity;P:unknown;C:unknownO.I.C.G.H.G.
38.199.818.7At2g22960816827serine carboxypeptidase S10 family proteinF:serine-type carboxypeptidase activity;P:proteolysis;C:endomembrane system;PMOFO.I.C.G.H.G.
38.099.857.0At3g15352820770ATCOX17Encodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex.O.I.C.G.H.G.
38.099.826.9At1g50160841438-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
37.599.77.6At3g24130821999pectinesterase family proteinF:pectinesterase activity;P:cell wall modification;C:endomembrane system, cell wall, plant-type cell wall;PBFAMOO.I.C.G.H.G.
36.899.712.7At1g36000840503LBD5 (LOB DOMAIN-CONTAINING PROTEIN 5)F:unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.



Back to the CoP portal site

Back to the KAGIANA project homepage