Microarray experiments to specifically-expressed genes

GSM ID -
Assay name E-MEXP-509-raw-cel-829148738
GSE experiment -

Click Gene ID to show a list of GSM assays in which the gene are specifically expressed.

Std2 GX %ile Std GX Gene ID Repr. ID Gene name Functional description O.I. C.G. H.G. Other DB
199.8100.062.9At5g35480833512unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
176.1100.0284.7At1g24822839086unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
173.5100.0104.3At4g33310829467unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
160.699.9244.0At1g53885841826senescence-associated protein-relatedF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
138.799.9174.3At3g14340820654unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
138.599.9159.4At1g356123766952transposable element genepseudogene of Ulp1 protease family proteinO.I.C.G.H.G.
134.799.9100.1At4g31030829230unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
125.099.914.7At5g25130832584CYP71B12putative cytochrome P450O.I.C.G.H.G.
111.299.943.1At3g05080819670unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
110.499.957.4At5g12450831120-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
108.599.948.3At4g15690827246glutaredoxin family proteinF:electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity;P:cell redox homeostasis;C:endomembrane system;PMFOBO.I.C.G.H.G.
92.599.925.2At2g13660815851unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
92.399.941.0At5g03210831903unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PO.I.C.G.H.G.
88.199.953.8At5g60400836162unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
76.799.945.8At2g23430816875ICK1Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1.O.I.C.G.H.G.
75.899.9105.9At5g35490833513unknown proteinEncodes MRU1 (mto 1 responding up). Up-regulated in mto1-1 mutant that over-accumulates soluble methionine.O.I.C.G.H.G.
74.299.99.3At5g57310835836unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
74.199.9108.9At5g51620835236-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
73.899.928.1At3g02390820514unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
73.299.970.3At3g46390823789unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
71.899.985.3At3g204703768804GRP5 (GLYCINE-RICH PROTEIN 5)encodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers.O.I.C.G.H.G.
69.699.953.4At4g15660827243glutaredoxin family proteinF:electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity;P:cell redox homeostasis;C:endomembrane system;PMFOBO.I.C.G.H.G.
69.599.937.8At2g01310814659unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
68.599.970.6At1g16400838210CYP79F2Encodes cytochrome P450 CYP79F2.O.I.C.G.H.G.
68.399.930.3At1g23610838971unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
66.299.835.8At1g49245841348-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PMO.I.C.G.H.G.
62.299.819.4At5g39620833958AtRABG1 (Arabidopsis Rab GTPase homolog G1)F:GTP binding;P:protein transport, small GTPase mediated signal transduction;C:unknown;MOFPBVAO.I.C.G.H.G.
59.699.8142.2At5g49640835026unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
58.999.8433.2At2g43530818954trypsin inhibitor, putativeEncodes a defensin-like (DEFL) family protein.O.I.C.G.H.G.
58.999.836.7At2g25990817140unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknownO.I.C.G.H.G.
58.099.823.1At2g22960816827serine carboxypeptidase S10 family proteinF:serine-type carboxypeptidase activity;P:proteolysis;C:endomembrane system;PMOFO.I.C.G.H.G.
57.899.826.5At5g09990830860PROPEP5 (Elicitor peptide 5 precursor)F:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
57.199.818.7At1g32570840151unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
56.199.832.6At1g50160841438-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
54.699.867.9At5g64180836539unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFBO.I.C.G.H.G.
54.599.822.7At1g33000840195transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
53.199.817.4At1g61610842457S-locus lectin protein kinase family proteinF:in 6 functions;P:protein amino acid phosphorylation, recognition of pollen;C:endomembrane system;MPOBFVAO.I.C.G.H.G.
53.099.8158.1At2g18440816358GUT15 (GENE WITH UNSTABLE TRANSCRIPT 15)Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product.O.I.C.G.H.G.
51.099.825.5At5g17950831662unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
50.999.819.1At2g06255815182ELF4-L3 (ELF4-Like 3)F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POO.I.C.G.H.G.
50.899.826.0At4g39160830071DNA binding / transcription factorF:transcription factor activity, DNA binding;P:unknown;C:unknown;OMFBPVAO.I.C.G.H.G.
50.699.8280.5At5g35880833574transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
50.499.814.1At2g20070816526-F:molecular_function unknown;P:unknown;C:endomembrane system;PO.I.C.G.H.G.
50.199.813.5At3g28120822436unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane systemO.I.C.G.H.G.
49.499.817.2At1g19060838488unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
48.699.812.3At5g26970832755unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknownO.I.C.G.H.G.
48.599.8157.3At3g29210822575transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
48.499.820.2At2g02340814765AtPP2-B8 (Phloem protein 2-B8)F:carbohydrate binding;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
47.299.811.8At2g18070816319unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
46.899.848.7At2g28820--O.I.C.G.H.G.
46.299.832.3At3g61900825363auxin-responsive family proteinF:molecular_function unknown;P:response to auxin stimulus;C:cellular_component unknown;POO.I.C.G.H.G.
46.199.847.4At4g13195826934CLE44 (CLAVATA3/ESR-RELATED 44)Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770).O.I.C.G.H.G.
45.999.830.3At5g409203771388-F:unknown;P:unknown;C:unknownO.I.C.G.H.G.
45.799.88.3At4g16930827401disease resistance protein (TIR-NBS-LRR class), putativeF:transmembrane receptor activity;P:signal transduction, defense response, innate immune response;C:intrinsic to membrane;PO.I.C.G.H.G.
45.699.817.3At2g01780814709S-locus glycoprotein, putativeF:sugar binding;P:recognition of pollen;C:cellular_component unknown;PO.I.C.G.H.G.
44.299.823.0At2g05870815139transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
44.099.836.0At1g65170842824ubiquitin carboxyl-terminal hydrolase family proteinF:ubiquitin thiolesterase activity;P:ubiquitin-dependent protein catabolic process;C:cellular_component unknown;PMOO.I.C.G.H.G.
43.299.86.0At1g23910839002-F:molecular_function unknown;P:response to biotic stimulus, defense response;C:cellular_component unknown;PO.I.C.G.H.G.
42.399.825.1At2g02520814782-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
42.299.8413.8At1g66100842924thionin, putativePredicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660.O.I.C.G.H.G.
41.699.830.8At5g51390835213unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
41.299.881.2At2g42190818819unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOFPVBAO.I.C.G.H.G.
41.199.826.7At5g36090833605transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
40.799.88.7At5g35510833515unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
40.699.870.3At4g16860827395RPP4 (recognition of peronospora parasitica 4)Confers resistance to Peronospora parasitica. RPP4 is coordinately regulated by transcriptional activation and RNA silencing.O.I.C.G.H.G.
40.699.846.4At5g07100830601WRKY26Encodes WRKY DNA-binding protein 26 (WRKY26).O.I.C.G.H.G.
40.399.8345.9At4g37300829885MEE59 (maternal effect embryo arrest 59)F:molecular_function unknown;P:embryonic development ending in seed dormancy;C:cellular_component unknown;PO.I.C.G.H.G.
40.399.815.6At5g35270833481transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
39.999.819.3At1g29610839838-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
39.899.824.7At4g31570829284unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOBFPAVO.I.C.G.H.G.
39.299.815.3At2g02550814785nucleaseF:nuclease activity;P:DNA repair;C:unknown;MFOPAO.I.C.G.H.G.
38.899.813.8At1g50930841515unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMPFVBO.I.C.G.H.G.
38.499.825.9At5g08210830717MIR834aEncodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAAO.I.C.G.H.G.
38.299.816.1At5g17200831584glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family proteinF:polygalacturonase activity;P:carbohydrate metabolic process;C:endomembrane system;FPBOMVAO.I.C.G.H.G.
37.999.8100.0At3g51890824352protein binding / structural moleculeF:protein binding, structural molecule activity;P:intracellular protein transport, vesicle-mediated transport;C:clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit;MPFOBO.I.C.G.H.G.
37.899.812.9At1g36000840503LBD5 (LOB DOMAIN-CONTAINING PROTEIN 5)F:unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
37.699.74.0At1g348423766925transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
37.499.79.8At2g18200816335unknown proteinF:molecular_function unknown;P:biological_process unknown;C:mitochondrion;PO.I.C.G.H.G.
37.299.721.5At3g16750820927unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMBFPAVO.I.C.G.H.G.
36.599.710.0At2g05500815099unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
36.399.7111.3At5g65870836716ATPSK5 (PHYTOSULFOKINE 5 PRECURSOR)Probable phytosulfokines 5 precursor, coding for a unique plant peptide growth factor.O.I.C.G.H.G.
36.399.715.4At5g46300834673unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OBMAPO.I.C.G.H.G.
35.599.716.8At1g59535842244unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
34.899.761.4At5g3980083397660S ribosomal protein-relatedF:molecular_function unknown;P:biological_process unknown;C:unknown;MFPOO.I.C.G.H.G.
34.799.714.1At1g67270843047-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFBO.I.C.G.H.G.
33.299.753.9At1g65790842890ARK1 (A. THALIANA RECEPTOR KINASE 1)An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain.O.I.C.G.H.G.
33.299.77.1At4g03680825668transposable element geneF:unknown;P:unknown;C:unknownO.I.C.G.H.G.
32.999.716.2At1g67635843087-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
32.699.719.9At4g17660827486protein kinase, putativeF:protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MPOBFVAO.I.C.G.H.G.
32.299.764.1At2g16365816133F-box family proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POO.I.C.G.H.G.
31.899.785.3At3g11230820293yippee family proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;MFPOO.I.C.G.H.G.
31.799.712.1At1g20970838691-F:molecular_function unknown;P:biological_process unknown;C:plasma membrane, vacuole;MOBFPAVO.I.C.G.H.G.
31.599.726.6At5g39870833984unknown proteinF:unknown;P:unknown;C:endomembrane system;POBMAO.I.C.G.H.G.
31.299.737.4At1g02680837962TAF13 (TBP-ASSOCIATED FACTOR 13)F:RNA polymerase II transcription factor activity, DNA binding;P:transcription initiation, transcription from RNA polymerase II promoter;C:transcription factor complex;FMPOVO.I.C.G.H.G.
31.299.719.7At3g17080820965self-incompatibility protein-relatedF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PMO.I.C.G.H.G.
30.999.771.9At2g28720817421histone H2B, putativeF:DNA binding;P:nucleosome assembly;C:nucleus, nucleosome;MOPFBO.I.C.G.H.G.
30.899.720.2At5g67180836853AP2 domain-containing transcription factor, putativeF:transcription factor activity, DNA binding;P:multicellular organismal development, response to heat, regulation of transcription, DNA-dependent;C:nucleus;POBVO.I.C.G.H.G.
30.099.714.7At4g03440827920ankyrin repeat family proteinF:protein binding;P:unknown;C:unknown;MOPBFVAO.I.C.G.H.G.
29.999.715.1At4g02910828141unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
29.899.712.0At3g04270819582unknown proteinF:unknown;P:unknown;C:cellular_component unknown;PO.I.C.G.H.G.



Back to the CoP portal site

Back to the KAGIANA project homepage