Microarray experiments to specifically-expressed genes

GSM ID -
Assay name E-MEXP-509-raw-cel-829148703
GSE experiment -

Click Gene ID to show a list of GSM assays in which the gene are specifically expressed.

Std2 GX %ile Std GX Gene ID Repr. ID Gene name Functional description O.I. C.G. H.G. Other DB
1458.6100.0129.2At1g10690837612unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
1213.0100.0471.5At1g356123766952transposable element genepseudogene of Ulp1 protease family proteinO.I.C.G.H.G.
1112.9100.0293.3At2g18670816382zinc finger (C3HC4-type RING finger) family proteinF:protein binding, zinc ion binding;P:unknown;C:unknown;PMOFVO.I.C.G.H.G.
835.1100.0146.6At4g39190830074unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMFBPVAO.I.C.G.H.G.
786.4100.0222.0At4g33310829467unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
784.8100.0308.9At3g14200820637DNAJ heat shock N-terminal domain-containing proteinF:heat shock protein binding;P:protein folding;C:cellular_component unknown;BOMFPAVO.I.C.G.H.G.
616.1100.0187.1At1g23830838994unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PO.I.C.G.H.G.
609.3100.0191.6At5g05090830391myb family transcription factorF:transcription factor activity, DNA binding;P:regulation of transcription;C:unknown;POO.I.C.G.H.G.
609.1100.0269.2At2g07718815392cytochrome b, putativeF:electron carrier activity, oxidoreductase activity;P:respiratory electron transport chain;C:membrane;MOPBO.I.C.G.H.G.
599.2100.0140.3At5g60400836162unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
571.7100.0207.4At5g62950836415catalytic/ nucleotide bindingF:catalytic activity, nucleotide binding;P:cellular metabolic process;C:cellular_component unknown;MFPOO.I.C.G.H.G.
484.6100.096.7At1g49245841348-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PMO.I.C.G.H.G.
423.8100.0146.6At2g28820--O.I.C.G.H.G.
417.7100.0814.3At2g40060818594protein binding / structural moleculeF:protein binding, structural molecule activity;P:intracellular protein transport, vesicle-mediated transport;C:plasma membrane, chloroplast envelope;MOPFBAVO.I.C.G.H.G.
350.2100.0280.0At2g43350818936ATGPX3 (GLUTATHIONE PEROXIDASE 3)Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1.O.I.C.G.H.G.
347.3100.098.5At1g61240842417unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PBOO.I.C.G.H.G.
315.7100.081.7At4g39890830148AtRABH1c (Arabidopsis Rab GTPase homolog H1c)F:protein binding, GTP binding;P:protein transport, small GTPase mediated signal transduction;C:endomembrane system;MOFPBVAO.I.C.G.H.G.
309.6100.0222.5At5g51620835236-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
303.0100.073.1At4g30820829205cyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-relatedF:molecular_function unknown;P:cell cycle;C:nucleus;MFPOO.I.C.G.H.G.
279.6100.0149.8At2g23680816899stress-responsive protein, putativeF:molecular_function unknown;P:response to stress;C:membrane;PO.I.C.G.H.G.
268.0100.0242.3At3g14340820654unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
253.1100.075.6At3g61900825363auxin-responsive family proteinF:molecular_function unknown;P:response to auxin stimulus;C:cellular_component unknown;POO.I.C.G.H.G.
252.6100.0377.5At4g16146827304-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
233.0100.072.6At1g52710841704cytochrome c oxidase-relatedF:cytochrome-c oxidase activity;P:biological_process unknown;C:mitochondrial envelope;MPOFO.I.C.G.H.G.
227.4100.0173.6At5g05610830444AL1 (ALFIN-LIKE 1)AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.O.I.C.G.H.G.
222.8100.019.6At5g48770834935disease resistance protein (TIR-NBS-LRR class), putativeF:transmembrane receptor activity, protein binding, ATP binding;P:signal transduction, defense response, apoptosis, innate immune response;C:intrinsic to membrane;PMBOFAO.I.C.G.H.G.
220.8100.0139.2At1g13700837931glucosamine/galactosamine-6-phosphate isomerase family proteinF:6-phosphogluconolactonase activity, catalytic activity;P:pentose-phosphate shunt, carbohydrate metabolic process;C:cellular_component unknown;BOFMPO.I.C.G.H.G.
208.0100.0235.8At1g14200837980zinc finger (C3HC4-type RING finger) family proteinF:protein binding, zinc ion binding;P:unknown;C:unknown;PMOFVBO.I.C.G.H.G.
203.8100.0103.5At5g07690830662ATMYB29 (ARABIDOPSIS THALIANA MYB DOMAIN PROTEIN 29)Encodes a putative transcription factor (MYB29).O.I.C.G.H.G.
202.7100.0490.8At5g03030831703DNAJ heat shock N-terminal domain-containing proteinF:heat shock protein binding;P:protein folding;C:unknown;OMFBPVO.I.C.G.H.G.
202.1100.0775.0At4g37300829885MEE59 (maternal effect embryo arrest 59)F:molecular_function unknown;P:embryonic development ending in seed dormancy;C:cellular_component unknown;PO.I.C.G.H.G.
199.4100.081.1At4g17960827521unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
186.4100.071.9At5g16610831523unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POO.I.C.G.H.G.
173.7100.092.0At4g13195826934CLE44 (CLAVATA3/ESR-RELATED 44)Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770).O.I.C.G.H.G.
168.7100.0232.8At3g05760819745nucleic acid binding / zinc ion bindingF:zinc ion binding, nucleic acid binding;P:biological_process unknown;C:intracellular;MOFPBAVO.I.C.G.H.G.
168.5100.0297.4At5g52750835352heavy-metal-associated domain-containing proteinF:metal ion binding;P:metal ion transport;C:cellular_component unknown;PBOMO.I.C.G.H.G.
160.499.91022.3At1g32460840140unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
159.499.9121.6At5g09240830783transcriptional coactivator p15 (PC4) family proteinF:transcription coactivator activity, binding, DNA binding;P:regulation of transcription, DNA-dependent;C:cellular_component unknown;MPFOO.I.C.G.H.G.
157.399.9556.8At1g18730838455NDF6 (NDH DEPENDENT FLOW 6)likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity.O.I.C.G.H.G.
146.399.9136.6At2g16365816133F-box family proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POO.I.C.G.H.G.
142.499.9236.8At5g54490835537PBP1 (PINOID-BINDING PROTEIN 1)Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels.O.I.C.G.H.G.
139.299.9178.4At3g11230820293yippee family proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;MFPOO.I.C.G.H.G.
139.199.959.8At1g71910843522unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
130.499.9396.1At5g61660836288glycine-rich proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;BMOPFVAO.I.C.G.H.G.
126.899.9257.5At1g53400841776unknown proteinF:unknown;P:N-terminal protein myristoylation;C:cellular_component unknown;MPFOO.I.C.G.H.G.
121.999.9175.2At4g28480828965DNAJ heat shock family proteinF:unfolded protein binding, heat shock protein binding;P:protein folding;C:cellular_component unknown;OBMFPAVO.I.C.G.H.G.
120.499.977.2At1g80420844382DNA repair protein, putative (XRCC1)F:transcription coactivator activity;P:DNA repair;C:intracellular;MPOFO.I.C.G.H.G.
119.199.9289.6At4g33660829507unknown proteinF:unknown;P:unknown;C:unknown;MPOFBVAO.I.C.G.H.G.
118.399.9151.1At3g13480820550unknown proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;POO.I.C.G.H.G.
111.799.9315.2At4g36990829853HSF4 (HEAT SHOCK FACTOR 4)encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins.O.I.C.G.H.G.
111.599.9166.6At5g23440832410FTRA1 (ferredoxin/thioredoxin reductase subunit A (variable subunit) 1)F:ferredoxin:thioredoxin reductase activity, lipoate synthase activity, catalytic activity, ferredoxin reductase activity;P:photosynthesis, light reaction, lipoate biosynthetic process, photosynthesis;C:chloroplast;BPFOO.I.C.G.H.G.
108.399.9643.4At1g32920840186unknown proteinF:molecular_function unknown;P:response to wounding;C:endomembrane system;PO.I.C.G.H.G.
102.699.968.7At3g45730823715unknown proteinF:molecular_function unknown;P:biological_process unknown;C:unknown;PO.I.C.G.H.G.
96.999.972.7At3g25010822092AtRLP41 (Receptor Like Protein 41)F:protein binding, kinase activity;P:signal transduction, defense response;C:endomembrane system;PMOBFAVO.I.C.G.H.G.
95.399.9150.2At4g04620825794ATG8B (autophagy 8b)F:microtubule binding;P:autophagy;C:unknown;MOPFVO.I.C.G.H.G.
93.899.9289.1At5g55850835679NOINOI proteinO.I.C.G.H.G.
93.099.9308.9At1g60010842295unknown proteinF:molecular_function unknown;P:N-terminal protein myristoylation;C:cellular_component unknown;PFOO.I.C.G.H.G.
82.399.983.4At5g64180836539unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFBO.I.C.G.H.G.
82.199.941.8At5g29000833026myb family transcription factorF:transcription factor activity, DNA binding;P:regulation of transcription;C:nucleus, chloroplast;POMFBO.I.C.G.H.G.
81.999.9427.9At4g30660829189hydrophobic protein, putative / low temperature and salt responsive protein, putativeF:unknown;P:hyperosmotic salinity response, response to cold;C:endomembrane system, integral to membrane;BFPMOO.I.C.G.H.G.
81.099.944.3At1g03200839553unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
78.799.9209.1At2g15580816051zinc finger (C3HC4-type RING finger) family proteinF:protein binding, zinc ion binding;P:unknown;C:unknown;PMOFBVO.I.C.G.H.G.
78.599.937.0At5g08210830717MIR834aEncodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAAO.I.C.G.H.G.
77.499.939.3At5g409203771388-F:unknown;P:unknown;C:unknownO.I.C.G.H.G.
76.899.941.8At1g79200844261unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOFPBO.I.C.G.H.G.
76.799.935.8At3g05080819670unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
76.599.945.3At1g64405842749unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
75.899.9120.4At2g23340816866AP2 domain-containing transcription factor, putativeencodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.O.I.C.G.H.G.
73.699.934.7At5g41650834167lactoylglutathione lyase family protein / glyoxalase I family proteinF:catalytic activity;P:metabolic process;C:cellular_component unknown;PBOO.I.C.G.H.G.
73.499.9812.8At5g54760835566eukaryotic translation initiation factor SUI1, putativeF:translation initiation factor activity;P:translational initiation, translation;C:cellular_component unknown;MPFOAVBO.I.C.G.H.G.
73.099.953.2At3g44020823519thylakoid lumenal P17.1 proteinF:unknown;P:unknown;C:chloroplast thylakoid lumen;POO.I.C.G.H.G.
72.399.9150.7At1g30135839893JAZ8 (JASMONATE-ZIM-DOMAIN PROTEIN 8)F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
72.199.9689.3At2g2521081705960S ribosomal protein L39 (RPL39A)F:structural constituent of ribosome;P:translation;C:cytosolic large ribosomal subunit, ribosome;MAFOPO.I.C.G.H.G.
70.799.9572.9At5g46020834642unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMBFPVAO.I.C.G.H.G.
69.299.987.7At3g14080820624small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putativeF:molecular_function unknown;P:unknown;C:small nucleolar ribonucleoprotein complex, nucleus;MFPOAO.I.C.G.H.G.
67.799.910.7At1g72600843592hydroxyproline-rich glycoprotein family proteinF:molecular_function unknown;P:biological_process unknown;C:endomembrane system;PMFOBAVO.I.C.G.H.G.
66.999.864.7At5g03440831839unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
66.199.8129.1At3g53470824515unknown proteinF:molecular_function unknown;P:biological_process unknown;C:chloroplast thylakoid membrane, chloroplast;PO.I.C.G.H.G.
65.799.868.4At1g03550839464secretory carrier membrane protein (SCAMP) family proteinF:transmembrane transporter activity;P:protein transport;C:integral to membrane;MPOFO.I.C.G.H.G.
65.099.865.9At1g22050838810MUB6 (MEMBRANE-ANCHORED UBIQUITIN-FOLD PROTEIN 6 PRECURSOR)F:molecular_function unknown;P:protein modification process;C:cellular_component unknown;PMO.I.C.G.H.G.
63.099.837.1At2g20500816571unknown proteinF:molecular_function unknown;P:biological_process unknown;C:mitochondrion;PO.I.C.G.H.G.
62.599.898.7At3g57480824915zinc finger (C2H2 type, AN1-like) family proteinF:zinc ion binding, nucleic acid binding;P:biological_process unknown;C:intracellular;MFOPO.I.C.G.H.G.
61.199.8223.3At5g53160835397unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.C.G.H.G.
59.299.873.7At3g06810819865IBR3 (IBA-RESPONSE 3)Encodes a protein with similarity to acyl-CoA dehydrogenases. Mutations in IBR3 render plants resistant to indole-3-butryic acid, a putative storage form of the biologically active auxin IAA (indole-3-acetic acid). IBR3 is hypothesized to carry out the second step in a β-oxidation-like process of IBA metabolism in Arabidopsis. Though its subcellular location has not been determined, IBR3 has a peroxisomal targeting sequence and two other putative IBA metabolic enzymes (IBR1 and IBR10) can be found in this organelle. No specific enzymatic activity has been documented for IBR3, but double mutant analyses with CHY1 argue against a role for IBR3 in general fatty acid β-oxidation.O.I.C.G.H.G.
58.299.8349.7At4g27410828849RD26 (RESPONSIVE TO DESICCATION 26)Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.O.I.C.G.H.G.
58.099.8240.6At5g20350832157TIP1 (TIP GROWTH DEFECTIVE 1)Encodes a protein containing ankyrin and DHHC-CRD domain. Acts to restrict the size of the swelling that forms at the beginning of root hair cell growth, possibly by a mechanism that requires RHD1. Mutant displays defects in both root hair and pollen tube growth.O.I.C.G.H.G.
57.699.8476.8At3g60600825231VAP (VESICLE ASSOCIATED PROTEIN)Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2.O.I.C.G.H.G.
57.699.869.5At3g25940822191transcription factor S-II (TFIIS) domain-containing proteinF:transcription factor activity, transcription regulator activity, DNA binding, zinc ion binding, nucleic acid binding;P:RNA elongation, regulation of transcription, DNA-dependent, regulation of transcription;C:nucleus;MFOAPVO.I.C.G.H.G.
57.599.873.9At5g01960831906zinc finger (C3HC4-type RING finger) family proteinF:protein binding, zinc ion binding;P:unknown;C:chloroplast;MOPFVO.I.C.G.H.G.
57.099.8132.5At2g26060817147emb1345 (embryo defective 1345)F:nucleotide binding;P:embryonic development ending in seed dormancy;C:heterotrimeric G-protein complex;MFOBPAO.I.C.G.H.G.
57.099.889.4At1g03290838603unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOBFPAVO.I.C.G.H.G.
55.999.827.3At5g67180836853AP2 domain-containing transcription factor, putativeF:transcription factor activity, DNA binding;P:multicellular organismal development, response to heat, regulation of transcription, DNA-dependent;C:nucleus;POBVO.I.C.G.H.G.
54.199.8643.9At5g64140836535RPS28 (RIBOSOMAL PROTEIN S28)Encodes a putative ribosomal protein S28.O.I.C.G.H.G.
54.199.8132.4At2g40110818600yippee family proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MFPOO.I.C.G.H.G.
53.699.868.1At1g74410843782zinc finger (C3HC4-type RING finger) family proteinF:protein binding, zinc ion binding;P:response to chitin;C:unknown;PMOFVBO.I.C.G.H.G.
53.299.8237.0At5g25540832629CID6 (CTC-Interacting Domain 6)Expressed protein contains PAM2 PABC interacting domain.O.I.C.G.H.G.
52.999.828.6At5g67390836875unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POO.I.C.G.H.G.
52.799.8102.1At2g47700819383zinc finger (C3HC4-type RING finger) family proteinF:ubiquitin-protein ligase activity, protein binding, zinc ion binding;P:unknown;C:unknown;MPOFO.I.C.G.H.G.
52.599.868.3At3g486503769688-F:unknown;P:unknown;C:unknownO.I.C.G.H.G.
52.599.863.0At2g07679815355ribosomal protein, putativeF:structural constituent of ribosome;P:translation;C:ribosome;PO.I.C.G.H.G.



Back to the CoP portal site

Back to the KAGIANA project homepage