CoP: Co-expressed Biological Processes

Microarray experiments to specifically-expressed genes

GSM ID -

Assay name E-MEXP-509-raw-cel-829148666

GSE experiment -

Click Gene ID to show a list of GSM assays in which the gene are specifically expressed.

Std2 GX %ile Std GX Gene ID Repr. ID Gene name Functional description O.I. C.G. H.G. Other DB
680.1 100.0 192.6 At3g25010 822092 AtRLP41 (Receptor Like Protein 41) F:protein binding, kinase activity;P:signal transduction, defense response;C:endomembrane system;PMOBFAV O.I. C.G. H.G.
444.3 100.0 63.7 At3g25020 822093 AtRLP42 (Receptor Like Protein 42) F:protein binding;P:signal transduction, defense response;C:endomembrane system;PMOBFAV O.I. C.G. H.G.
436.5 100.0 106.0 At4g39190 830074 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMFBPVA O.I. C.G. H.G.
217.4 100.0 116.7 At4g33310 829467 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
200.4 100.0 57.9 At3g05080 819670 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
188.5 100.0 219.2 At1g21525 3766777 - pseudogene of unknown protein O.I. C.G. H.G.
161.4 99.9 54.3 At5g03210 831903 unknown protein F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P O.I. C.G. H.G.
159.4 99.9 98.1 At3g51440 824307 strictosidine synthase family protein F:strictosidine synthase activity;P:alkaloid biosynthetic process, biosynthetic process;C:endoplasmic reticulum;BPMOFA O.I. C.G. H.G.
155.4 99.9 16.4 At5g25130 832584 CYP71B12 putative cytochrome P450 O.I. C.G. H.G.
147.0 99.9 26.6 At3g24900 822088 AtRLP39 (Receptor Like Protein 39) F:protein binding;P:signal transduction, defense response;C:endomembrane system;PMOBFAV O.I. C.G. H.G.
146.8 99.9 46.9 At4g04220 825737 AtRLP46 (Receptor Like Protein 46) F:protein binding, kinase activity;P:signal transduction, defense response;C:endomembrane system;PMOBFAV O.I. C.G. H.G.
131.7 99.9 186.4 At3g51890 824352 protein binding / structural molecule F:protein binding, structural molecule activity;P:intracellular protein transport, vesicle-mediated transport;C:clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit;MPFOB O.I. C.G. H.G.
123.9 99.9 35.1 At4g11840 826790 PLDGAMMA3 member of C2-PLD subfamily O.I. C.G. H.G.
105.9 99.9 145.1 At3g47480 823902 calcium-binding EF hand family protein F:calcium ion binding;P:biological_process unknown;C:endomembrane system;MPFOB O.I. C.G. H.G.
100.0 99.9 26.2 At2g13660 815851 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
99.4 99.9 86.0 At4g31030 829230 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
90.2 99.9 53.0 At1g15790 838148 unknown protein F:unknown;P:unknown;C:unknown;P O.I. C.G. H.G.
83.2 99.9 74.3 At1g78410 844177 VQ motif-containing protein F:molecular_function unknown;P:response to oxidative stress;C:cellular_component unknown;P O.I. C.G. H.G.
83.2 99.9 60.8 At4g13900 3770199 - F:unknown;P:unknown;C:unknown O.I. C.G. H.G.
81.0 99.9 39.6 At1g49245 841348 - F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PM O.I. C.G. H.G.
80.9 99.9 28.7 At4g33610 829501 glycine-rich protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;BMPOVF O.I. C.G. H.G.
79.7 99.9 40.5 At2g01310 814659 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
79.4 99.9 105.8 At3g28540 822484 AAA-type ATPase family protein F:nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding;P:unknown;C:unknown;BOMFPAV O.I. C.G. H.G.
79.1 99.9 32.4 At4g39160 830071 DNA binding / transcription factor F:transcription factor activity, DNA binding;P:unknown;C:unknown;OMFBPVA O.I. C.G. H.G.
77.7 99.9 130.4 At3g14340 820654 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
76.9 99.9 39.2 At5g40920 3771388 - F:unknown;P:unknown;C:unknown O.I. C.G. H.G.
75.9 99.9 81.5 At1g65790 842890 ARK1 (A. THALIANA RECEPTOR KINASE 1) An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain. O.I. C.G. H.G.
75.0 99.9 159.6 At5g49640 835026 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
69.7 99.9 45.6 At5g12450 831120 - F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
69.5 99.9 30.5 At1g23610 838971 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
68.5 99.9 25.5 At1g33000 840195 transposable element gene F:unknown;P:unknown;C:unknown O.I. C.G. H.G.
67.3 99.8 197.6 At3g03640 821201 BGLU25 (BETA GLUCOSIDASE 25) Encodes beta-glucosidase (GLUC). O.I. C.G. H.G.
67.0 99.8 96.9 At1g03290 838603 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOBFPAV O.I. C.G. H.G.
66.2 99.8 29.0 At5g17950 831662 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
65.8 99.8 74.5 At5g64180 836539 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFB O.I. C.G. H.G.
65.4 99.8 102.3 At5g51620 835236 - F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
63.8 99.8 33.4 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA O.I. C.G. H.G.
61.3 99.8 25.0 At3g53770 824544 late embryogenesis abundant protein-related / LEA protein-related F:molecular_function unknown;P:response to stress;C:unknown;P O.I. C.G. H.G.
60.5 99.8 85.9 At5g46230 834665 unknown protein F:unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
60.3 99.8 25.8 At1g66460 842964 protein kinase family protein F:protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MPOBFVA O.I. C.G. H.G.
58.9 99.8 27.3 At1g55990 842050 glycine-rich protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;BOPM O.I. C.G. H.G.
57.8 99.8 51.6 At3g45730 823715 unknown protein F:molecular_function unknown;P:biological_process unknown;C:unknown;P O.I. C.G. H.G.
57.3 99.8 162.4 At1g24822 839086 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
55.9 99.8 20.1 At2g06255 815182 ELF4-L3 (ELF4-Like 3) F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO O.I. C.G. H.G.
55.8 99.8 77.8 At5g39800 833976 60S ribosomal protein-related F:molecular_function unknown;P:biological_process unknown;C:unknown;MFPO O.I. C.G. H.G.
55.8 99.8 8.1 At5g57310 835836 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
55.5 99.8 40.0 At2g39500 818535 unknown protein F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P O.I. C.G. H.G.
54.2 99.8 35.2 At2g25990 817140 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown O.I. C.G. H.G.
54.2 99.8 24.9 At1g10690 837612 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
54.1 99.8 44.1 At5g46350 834678 WRKY8 member of WRKY Transcription Factor; Group II-c O.I. C.G. H.G.
53.9 99.8 24.0 At3g02390 820514 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
53.0 99.8 140.1 At1g53885 841826 senescence-associated protein-related F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
52.5 99.8 8.9 At4g16930 827401 disease resistance protein (TIR-NBS-LRR class), putative F:transmembrane receptor activity;P:signal transduction, defense response, innate immune response;C:intrinsic to membrane;P O.I. C.G. H.G.
52.2 99.8 79.8 At4g16860 827395 RPP4 (recognition of peronospora parasitica 4) Confers resistance to Peronospora parasitica. RPP4 is coordinately regulated by transcriptional activation and RNA silencing. O.I. C.G. H.G.
52.1 99.8 84.1 At4g29160 829037 SNF7.1 F:unknown;P:vesicle-mediated transport;C:ESCRT III complex;MFPOB O.I. C.G. H.G.
51.6 99.8 13.4 At5g65610 836687 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
51.3 99.8 25.0 At4g17660 827486 protein kinase, putative F:protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MPOBFVA O.I. C.G. H.G.
50.1 99.8 65.5 At3g15352 820770 ATCOX17 Encodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex. O.I. C.G. H.G.
49.5 99.8 19.4 At4g02910 828141 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
48.9 99.8 33.5 At5g25140 832585 CYP71B13 putative cytochrome P450 O.I. C.G. H.G.
48.7 99.8 118.4 At5g39670 833963 calcium-binding EF hand family protein F:calcium ion binding;P:biological_process unknown;C:cellular_component unknown;MPFOB O.I. C.G. H.G.
48.1 99.8 32.9 At3g57460 824913 catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding F:metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding;P:proteolysis;C:cellular_component unknown;MBFPO O.I. C.G. H.G.
46.1 99.8 100.5 At1g35230 840412 AGP5 (ARABINOGALACTAN-PROTEIN 5) Encodes arabinogalactan-protein (AGP5). O.I. C.G. H.G.
45.5 99.8 103.8 At4g04620 825794 ATG8B (autophagy 8b) F:microtubule binding;P:autophagy;C:unknown;MOPFV O.I. C.G. H.G.
45.1 99.8 59.4 At5g60800 836201 heavy-metal-associated domain-containing protein F:metal ion binding;P:metal ion transport;C:unknown;POMFBVA O.I. C.G. H.G.
44.9 99.8 15.9 At1g42980 840896 formin homology 2 domain-containing protein / FH2 domain-containing protein F:actin binding;P:unknown;C:endomembrane system;MPOF O.I. C.G. H.G.
44.2 99.8 19.3 At2g02340 814765 AtPP2-B8 (Phloem protein 2-B8) F:carbohydrate binding;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
43.7 99.8 13.1 At2g20070 816526 - F:molecular_function unknown;P:unknown;C:endomembrane system;P O.I. C.G. H.G.
43.4 99.8 86.2 At2g10950 815559 BSD domain-containing protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PMOBF O.I. C.G. H.G.
43.2 99.8 156.0 At4g16146 827304 - F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
43.2 99.8 10.9 At2g05500 815099 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
42.6 99.8 59.6 At1g53030 841736 cytochrome c oxidase copper chaperone family protein encodes a copper chaperone, can functional complements the yeast COX17 null mutant. May play a role in the delivery of copper to mitochondria. Expressed in roots and thus may also play a role in copper transport in the roots. O.I. C.G. H.G.
42.5 99.8 61.5 At3g48650 3769688 - F:unknown;P:unknown;C:unknown O.I. C.G. H.G.
42.4 99.8 141.4 At2g18440 816358 GUT15 (GENE WITH UNSTABLE TRANSCRIPT 15) Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. O.I. C.G. H.G.
41.8 99.8 30.2 At5g37130 833685 binding F:binding;P:biological_process unknown;C:apoplast;OBAMFP O.I. C.G. H.G.
41.4 99.8 74.8 At5g23760 832441 heavy-metal-associated domain-containing protein F:metal ion binding;P:metal ion transport;C:cellular_component unknown;OMPFABV O.I. C.G. H.G.
41.2 99.8 28.6 At5g35480 833512 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
41.2 99.8 15.6 At2g02550 814785 nuclease F:nuclease activity;P:DNA repair;C:unknown;MFOPA O.I. C.G. H.G.
41.1 99.8 20.6 At5g40460 834044 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
40.7 99.8 144.2 At3g29210 822575 transposable element gene F:unknown;P:unknown;C:unknown O.I. C.G. H.G.
40.3 99.8 34.6 At1g54110 841850 cation exchanger, putative (CAX10) F:cation:cation antiporter activity;P:cation transport;C:unknown;MPFOV O.I. C.G. H.G.
40.1 99.8 159.1 At4g32240 829357 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
39.6 99.8 27.4 At1g50160 841438 - F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
39.5 99.8 9.6 At1g31260 840014 ZIP10 (ZINC TRANSPORTER 10 PRECURSOR) member of Fe(II) transporter isolog family O.I. C.G. H.G.
38.9 99.8 298.3 At2g43970 819002 La domain-containing protein F:RNA binding, nucleic acid binding;P:RNA processing;C:ribonucleoprotein complex, nucleus, chloroplast;OMFPBVA O.I. C.G. H.G.
38.7 99.8 173.4 At5g45010 834532 ATDSS1(V) (Arabidopsis dss1 homolog on chromosome V) F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MFPO O.I. C.G. H.G.
38.6 99.8 20.4 At5g43510 834371 - - O.I. C.G. H.G.
37.9 99.8 21.2 At3g07610 819952 IBM1 (increase in bonsai methylation 1) IBM1 likely encodes a protein with histone H3mK9 demethylation activity. It may preferentially demethylate H3mK9 at low-copy loci to protect them from silencing by nearby heterochromatin by preventing the spread of cytosine methylation. BONSAI (At1g73177) is hypermethylated in ibm1 mutants. ibm1 mutants have morphological defects that become apparent at the F3 generation, including small narrow leaves, arrested flower development, and faulty pollen development. These phenotypes cannot result solely from the BONSAI hypermethylation. Aberrant phenotypes in ibm1 mutants in both DNA methylation and plant development can be suppressed by mutations in the KYP H3K9 methyltransferase or he CMT3 non CG-cytosine methylase. O.I. C.G. H.G.
37.8 99.8 140.9 At5g52750 835352 heavy-metal-associated domain-containing protein F:metal ion binding;P:metal ion transport;C:cellular_component unknown;PBOM O.I. C.G. H.G.
37.5 99.7 15.0 At1g19060 838488 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
37.3 99.7 33.2 At1g32630 840157 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PMFO O.I. C.G. H.G.
37.1 99.7 19.6 At2g03130 814842 ribosomal protein L12 family protein F:structural constituent of ribosome;P:translation;C:ribosome, intracellular, large ribosomal subunit;BOPMF O.I. C.G. H.G.
36.9 99.7 13.8 At5g46520 834695 ATP binding / nucleoside-triphosphatase/ nucleotide binding / protein binding / transmembrane receptor F:transmembrane receptor activity, protein binding, nucleoside-triphosphatase activity, nucleotide binding, ATP binding;P:signal transduction, defense response, apoptosis, innate immune response;C:intrinsic to membrane;PMBOFVA O.I. C.G. H.G.
36.8 99.7 74.0 At1g67920 843120 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
36.7 99.7 14.4 At1g61610 842457 S-locus lectin protein kinase family protein F:in 6 functions;P:protein amino acid phosphorylation, recognition of pollen;C:endomembrane system;MPOBFVA O.I. C.G. H.G.
36.5 99.7 340.8 At2g43530 818954 trypsin inhibitor, putative Encodes a defensin-like (DEFL) family protein. O.I. C.G. H.G.
35.6 99.7 34.0 At5g14930 831345 SAG101 (SENESCENCE-ASSOCIATED GENE 101) encodes an acyl hydrolase involved in senescence . O.I. C.G. H.G.
35.4 99.7 10.2 At2g18070 816319 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. C.G. H.G.
35.3 99.7 80.4 At1g35612 3766952 transposable element gene pseudogene of Ulp1 protease family protein O.I. C.G. H.G.
34.7 99.7 27.9 At5g39870 833984 unknown protein F:unknown;P:unknown;C:endomembrane system;POBMA O.I. C.G. H.G.

Std2 GX	%ile	Std GX	Gene ID	Repr. ID	Gene name	Functional description	O.I.	C.G.	H.G.
680.1	100.0	192.6	At3g25010	822092	AtRLP41 (Receptor Like Protein 41)	F:protein binding, kinase activity;P:signal transduction, defense response;C:endomembrane system;PMOBFAV	O.I.	C.G.	H.G.
444.3	100.0	63.7	At3g25020	822093	AtRLP42 (Receptor Like Protein 42)	F:protein binding;P:signal transduction, defense response;C:endomembrane system;PMOBFAV	O.I.	C.G.	H.G.
436.5	100.0	106.0	At4g39190	830074	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;OMFBPVA	O.I.	C.G.	H.G.
217.4	100.0	116.7	At4g33310	829467	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
200.4	100.0	57.9	At3g05080	819670	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
188.5	100.0	219.2	At1g21525	3766777	-	pseudogene of unknown protein	O.I.	C.G.	H.G.
161.4	99.9	54.3	At5g03210	831903	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P	O.I.	C.G.	H.G.
159.4	99.9	98.1	At3g51440	824307	strictosidine synthase family protein	F:strictosidine synthase activity;P:alkaloid biosynthetic process, biosynthetic process;C:endoplasmic reticulum;BPMOFA	O.I.	C.G.	H.G.
155.4	99.9	16.4	At5g25130	832584	CYP71B12	putative cytochrome P450	O.I.	C.G.	H.G.
147.0	99.9	26.6	At3g24900	822088	AtRLP39 (Receptor Like Protein 39)	F:protein binding;P:signal transduction, defense response;C:endomembrane system;PMOBFAV	O.I.	C.G.	H.G.
146.8	99.9	46.9	At4g04220	825737	AtRLP46 (Receptor Like Protein 46)	F:protein binding, kinase activity;P:signal transduction, defense response;C:endomembrane system;PMOBFAV	O.I.	C.G.	H.G.
131.7	99.9	186.4	At3g51890	824352	protein binding / structural molecule	F:protein binding, structural molecule activity;P:intracellular protein transport, vesicle-mediated transport;C:clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit;MPFOB	O.I.	C.G.	H.G.
123.9	99.9	35.1	At4g11840	826790	PLDGAMMA3	member of C2-PLD subfamily	O.I.	C.G.	H.G.
105.9	99.9	145.1	At3g47480	823902	calcium-binding EF hand family protein	F:calcium ion binding;P:biological_process unknown;C:endomembrane system;MPFOB	O.I.	C.G.	H.G.
100.0	99.9	26.2	At2g13660	815851	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
99.4	99.9	86.0	At4g31030	829230	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
90.2	99.9	53.0	At1g15790	838148	unknown protein	F:unknown;P:unknown;C:unknown;P	O.I.	C.G.	H.G.
83.2	99.9	74.3	At1g78410	844177	VQ motif-containing protein	F:molecular_function unknown;P:response to oxidative stress;C:cellular_component unknown;P	O.I.	C.G.	H.G.
83.2	99.9	60.8	At4g13900	3770199	-	F:unknown;P:unknown;C:unknown	O.I.	C.G.	H.G.
81.0	99.9	39.6	At1g49245	841348	-	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PM	O.I.	C.G.	H.G.
80.9	99.9	28.7	At4g33610	829501	glycine-rich protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;BMPOVF	O.I.	C.G.	H.G.
79.7	99.9	40.5	At2g01310	814659	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
79.4	99.9	105.8	At3g28540	822484	AAA-type ATPase family protein	F:nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding;P:unknown;C:unknown;BOMFPAV	O.I.	C.G.	H.G.
79.1	99.9	32.4	At4g39160	830071	DNA binding / transcription factor	F:transcription factor activity, DNA binding;P:unknown;C:unknown;OMFBPVA	O.I.	C.G.	H.G.
77.7	99.9	130.4	At3g14340	820654	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
76.9	99.9	39.2	At5g40920	3771388	-	F:unknown;P:unknown;C:unknown	O.I.	C.G.	H.G.
75.9	99.9	81.5	At1g65790	842890	ARK1 (A. THALIANA RECEPTOR KINASE 1)	An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain.	O.I.	C.G.	H.G.
75.0	99.9	159.6	At5g49640	835026	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
69.7	99.9	45.6	At5g12450	831120	-	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
69.5	99.9	30.5	At1g23610	838971	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
68.5	99.9	25.5	At1g33000	840195	transposable element gene	F:unknown;P:unknown;C:unknown	O.I.	C.G.	H.G.
67.3	99.8	197.6	At3g03640	821201	BGLU25 (BETA GLUCOSIDASE 25)	Encodes beta-glucosidase (GLUC).	O.I.	C.G.	H.G.
67.0	99.8	96.9	At1g03290	838603	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MOBFPAV	O.I.	C.G.	H.G.
66.2	99.8	29.0	At5g17950	831662	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
65.8	99.8	74.5	At5g64180	836539	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFB	O.I.	C.G.	H.G.
65.4	99.8	102.3	At5g51620	835236	-	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
63.8	99.8	33.4	At5g08210	830717	MIR834a	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA	O.I.	C.G.	H.G.
61.3	99.8	25.0	At3g53770	824544	late embryogenesis abundant protein-related / LEA protein-related	F:molecular_function unknown;P:response to stress;C:unknown;P	O.I.	C.G.	H.G.
60.5	99.8	85.9	At5g46230	834665	unknown protein	F:unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
60.3	99.8	25.8	At1g66460	842964	protein kinase family protein	F:protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MPOBFVA	O.I.	C.G.	H.G.
58.9	99.8	27.3	At1g55990	842050	glycine-rich protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;BOPM	O.I.	C.G.	H.G.
57.8	99.8	51.6	At3g45730	823715	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:unknown;P	O.I.	C.G.	H.G.
57.3	99.8	162.4	At1g24822	839086	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
55.9	99.8	20.1	At2g06255	815182	ELF4-L3 (ELF4-Like 3)	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO	O.I.	C.G.	H.G.
55.8	99.8	77.8	At5g39800	833976	60S ribosomal protein-related	F:molecular_function unknown;P:biological_process unknown;C:unknown;MFPO	O.I.	C.G.	H.G.
55.8	99.8	8.1	At5g57310	835836	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
55.5	99.8	40.0	At2g39500	818535	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:endomembrane system;P	O.I.	C.G.	H.G.
54.2	99.8	35.2	At2g25990	817140	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown	O.I.	C.G.	H.G.
54.2	99.8	24.9	At1g10690	837612	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
54.1	99.8	44.1	At5g46350	834678	WRKY8	member of WRKY Transcription Factor; Group II-c	O.I.	C.G.	H.G.
53.9	99.8	24.0	At3g02390	820514	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
53.0	99.8	140.1	At1g53885	841826	senescence-associated protein-related	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
52.5	99.8	8.9	At4g16930	827401	disease resistance protein (TIR-NBS-LRR class), putative	F:transmembrane receptor activity;P:signal transduction, defense response, innate immune response;C:intrinsic to membrane;P	O.I.	C.G.	H.G.
52.2	99.8	79.8	At4g16860	827395	RPP4 (recognition of peronospora parasitica 4)	Confers resistance to Peronospora parasitica. RPP4 is coordinately regulated by transcriptional activation and RNA silencing.	O.I.	C.G.	H.G.
52.1	99.8	84.1	At4g29160	829037	SNF7.1	F:unknown;P:vesicle-mediated transport;C:ESCRT III complex;MFPOB	O.I.	C.G.	H.G.
51.6	99.8	13.4	At5g65610	836687	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
51.3	99.8	25.0	At4g17660	827486	protein kinase, putative	F:protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding;P:protein amino acid phosphorylation;C:cellular_component unknown;MPOBFVA	O.I.	C.G.	H.G.
50.1	99.8	65.5	At3g15352	820770	ATCOX17	Encodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex.	O.I.	C.G.	H.G.
49.5	99.8	19.4	At4g02910	828141	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
48.9	99.8	33.5	At5g25140	832585	CYP71B13	putative cytochrome P450	O.I.	C.G.	H.G.
48.7	99.8	118.4	At5g39670	833963	calcium-binding EF hand family protein	F:calcium ion binding;P:biological_process unknown;C:cellular_component unknown;MPFOB	O.I.	C.G.	H.G.
48.1	99.8	32.9	At3g57460	824913	catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding	F:metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding;P:proteolysis;C:cellular_component unknown;MBFPO	O.I.	C.G.	H.G.
46.1	99.8	100.5	At1g35230	840412	AGP5 (ARABINOGALACTAN-PROTEIN 5)	Encodes arabinogalactan-protein (AGP5).	O.I.	C.G.	H.G.
45.5	99.8	103.8	At4g04620	825794	ATG8B (autophagy 8b)	F:microtubule binding;P:autophagy;C:unknown;MOPFV	O.I.	C.G.	H.G.
45.1	99.8	59.4	At5g60800	836201	heavy-metal-associated domain-containing protein	F:metal ion binding;P:metal ion transport;C:unknown;POMFBVA	O.I.	C.G.	H.G.
44.9	99.8	15.9	At1g42980	840896	formin homology 2 domain-containing protein / FH2 domain-containing protein	F:actin binding;P:unknown;C:endomembrane system;MPOF	O.I.	C.G.	H.G.
44.2	99.8	19.3	At2g02340	814765	AtPP2-B8 (Phloem protein 2-B8)	F:carbohydrate binding;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
43.7	99.8	13.1	At2g20070	816526	-	F:molecular_function unknown;P:unknown;C:endomembrane system;P	O.I.	C.G.	H.G.
43.4	99.8	86.2	At2g10950	815559	BSD domain-containing protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PMOBF	O.I.	C.G.	H.G.
43.2	99.8	156.0	At4g16146	827304	-	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
43.2	99.8	10.9	At2g05500	815099	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
42.6	99.8	59.6	At1g53030	841736	cytochrome c oxidase copper chaperone family protein	encodes a copper chaperone, can functional complements the yeast COX17 null mutant. May play a role in the delivery of copper to mitochondria. Expressed in roots and thus may also play a role in copper transport in the roots.	O.I.	C.G.	H.G.
42.5	99.8	61.5	At3g48650	3769688	-	F:unknown;P:unknown;C:unknown	O.I.	C.G.	H.G.
42.4	99.8	141.4	At2g18440	816358	GUT15 (GENE WITH UNSTABLE TRANSCRIPT 15)	Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product.	O.I.	C.G.	H.G.
41.8	99.8	30.2	At5g37130	833685	binding	F:binding;P:biological_process unknown;C:apoplast;OBAMFP	O.I.	C.G.	H.G.
41.4	99.8	74.8	At5g23760	832441	heavy-metal-associated domain-containing protein	F:metal ion binding;P:metal ion transport;C:cellular_component unknown;OMPFABV	O.I.	C.G.	H.G.
41.2	99.8	28.6	At5g35480	833512	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
41.2	99.8	15.6	At2g02550	814785	nuclease	F:nuclease activity;P:DNA repair;C:unknown;MFOPA	O.I.	C.G.	H.G.
41.1	99.8	20.6	At5g40460	834044	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
40.7	99.8	144.2	At3g29210	822575	transposable element gene	F:unknown;P:unknown;C:unknown	O.I.	C.G.	H.G.
40.3	99.8	34.6	At1g54110	841850	cation exchanger, putative (CAX10)	F:cation:cation antiporter activity;P:cation transport;C:unknown;MPFOV	O.I.	C.G.	H.G.
40.1	99.8	159.1	At4g32240	829357	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
39.6	99.8	27.4	At1g50160	841438	-	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
39.5	99.8	9.6	At1g31260	840014	ZIP10 (ZINC TRANSPORTER 10 PRECURSOR)	member of Fe(II) transporter isolog family	O.I.	C.G.	H.G.
38.9	99.8	298.3	At2g43970	819002	La domain-containing protein	F:RNA binding, nucleic acid binding;P:RNA processing;C:ribonucleoprotein complex, nucleus, chloroplast;OMFPBVA	O.I.	C.G.	H.G.
38.7	99.8	173.4	At5g45010	834532	ATDSS1(V) (Arabidopsis dss1 homolog on chromosome V)	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MFPO	O.I.	C.G.	H.G.
38.6	99.8	20.4	At5g43510	834371	-	-	O.I.	C.G.	H.G.
37.9	99.8	21.2	At3g07610	819952	IBM1 (increase in bonsai methylation 1)	IBM1 likely encodes a protein with histone H3mK9 demethylation activity. It may preferentially demethylate H3mK9 at low-copy loci to protect them from silencing by nearby heterochromatin by preventing the spread of cytosine methylation. BONSAI (At1g73177) is hypermethylated in ibm1 mutants. ibm1 mutants have morphological defects that become apparent at the F3 generation, including small narrow leaves, arrested flower development, and faulty pollen development. These phenotypes cannot result solely from the BONSAI hypermethylation. Aberrant phenotypes in ibm1 mutants in both DNA methylation and plant development can be suppressed by mutations in the KYP H3K9 methyltransferase or he CMT3 non CG-cytosine methylase.	O.I.	C.G.	H.G.
37.8	99.8	140.9	At5g52750	835352	heavy-metal-associated domain-containing protein	F:metal ion binding;P:metal ion transport;C:cellular_component unknown;PBOM	O.I.	C.G.	H.G.
37.5	99.7	15.0	At1g19060	838488	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
37.3	99.7	33.2	At1g32630	840157	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PMFO	O.I.	C.G.	H.G.
37.1	99.7	19.6	At2g03130	814842	ribosomal protein L12 family protein	F:structural constituent of ribosome;P:translation;C:ribosome, intracellular, large ribosomal subunit;BOPMF	O.I.	C.G.	H.G.
36.9	99.7	13.8	At5g46520	834695	ATP binding / nucleoside-triphosphatase/ nucleotide binding / protein binding / transmembrane receptor	F:transmembrane receptor activity, protein binding, nucleoside-triphosphatase activity, nucleotide binding, ATP binding;P:signal transduction, defense response, apoptosis, innate immune response;C:intrinsic to membrane;PMBOFVA	O.I.	C.G.	H.G.
36.8	99.7	74.0	At1g67920	843120	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
36.7	99.7	14.4	At1g61610	842457	S-locus lectin protein kinase family protein	F:in 6 functions;P:protein amino acid phosphorylation, recognition of pollen;C:endomembrane system;MPOBFVA	O.I.	C.G.	H.G.
36.5	99.7	340.8	At2g43530	818954	trypsin inhibitor, putative	Encodes a defensin-like (DEFL) family protein.	O.I.	C.G.	H.G.
35.6	99.7	34.0	At5g14930	831345	SAG101 (SENESCENCE-ASSOCIATED GENE 101)	encodes an acyl hydrolase involved in senescence .	O.I.	C.G.	H.G.
35.4	99.7	10.2	At2g18070	816319	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	C.G.	H.G.
35.3	99.7	80.4	At1g35612	3766952	transposable element gene	pseudogene of Ulp1 protease family protein	O.I.	C.G.	H.G.
34.7	99.7	27.9	At5g39870	833984	unknown protein	F:unknown;P:unknown;C:endomembrane system;POBMA	O.I.	C.G.	H.G.

Back to the CoP portal site

Back to the KAGIANA project homepage

GSM ID	-
Assay name	E-MEXP-509-raw-cel-829148666
GSE experiment	-

Microarray experiments to specifically-expressed genes

GSM ID - Assay name E-MEXP-509-raw-cel-829148666 GSE experiment -

GSM ID -

Assay name E-MEXP-509-raw-cel-829148666

GSE experiment -