A change from the vegetative to the reproductive phase as a result of detection of, or exposure to, a period of light or dark of a given length. The length of the period of light or dark required to initiate the change is set relative to a particular duration known as the 'critical day length'. The critical day length varies between species.
Organism
Arabidopsis thaliana
Click Gene ID to show a list of co-expressed genes.
Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT.
U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.
FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1.
HAC1 (HISTONE ACETYLTRANSFERASE OF THE CBP FAMILY 1)
Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation.
This gene is predicted to an encode a nuclear-localized protein that is involved in regulating the period of circadian rhythms without affecting their amplitude or robustness. FIONA1 seems to act as a central oscillator-associated component, but its transcript levels are not regulated in a circadian or light-dependent manner. FIONA1 also appears to be involved in photoperiod-dependent flowering.
Encodes a novel nuclear protein that is expressed rhythmically and interacts with phytochrome B to control plant development and flowering through a signal transduction pathway Elf3 controls rhythmic circadian outputs under constant light conditions.
Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAU
Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light.
Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation.
Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes.
Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock.
Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes.
Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases.
EID1 is an F-box protein that functions as a negative regulator in phytochrome A (phyA)-specific light signalling. Expressed at all stages of plant development independently of light conditions, localizes to the nucleus, and forms nuclear speckles under continuous far-red light. Forms stable dimeric and trimeric complexes with several ASK proteins and Cullin1 in yeast and in planta.
Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state.
Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Interacts specifically with and phosphorylates AtVHA-C, subunit C of the vacuolar H+-ATPase.
U2 auxiliary factor small subunit. The atU2AF35b protein and its homolog, atU2AF35a, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.
Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS1 is the major small subunit isoform present in all plant tissues tested.
Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration due to higher accumulation of the second messenger, inositol (1,4,5)- triphosphate (IP(3)). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity.
Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR).
A genetic locus involved in flowering time. The mutant enhances the expression of the flowering time (FT) gene. A knockout mutant of this gene showed late-flowering phenotype.
A change in state or activity of the organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of detection of, or exposure to, a period of light or dark of a given length, measured relative to a particular duration known as the 'critical day length'. The critical day length varies between species.
The process involved in transforming a meristem that produces vegetative structures, such as leaves, into a meristem that produces reproductive structures, such as a flower or an inflorescence.
A change from the vegetative to the reproductive phase as a result of detection of, or exposure to, a period of light that exceeds the critical day length. The critical day length varies between species. Although the term is long-day is used, most species actually respond to the duration of the night, so that the response will occur when a period of darkness falls short of the number of hours defined by 24 minus the critical day length.
A change from vegetative to reproductive phase as a result of detection of, or exposure to, a period of light that falls short of the critical day length. The critical day length varies between species. Although the term is short-day is used, most species actually respond to the duration of the night, so that the response will occur when a period of darkness exceeds the number of hours defined by 24 minus the critical day length.
