Biological process to genes

Query process ID GO:0035279
Process name The process by which microRNAs (miRNAs) direct the cleavage of target mRNAs. Once incorporated into a RNA-induced silencing complex (RISC), a miRNA will typically direct cleavage by base pairing with near-perfect complementarity to the target mRNA. Many plant miRNAs downregulate gene expression through this mechanism.
Organism Arabidopsis thaliana

Click Gene ID to show a list of co-expressed genes.

ECC Gene ID Repr. ID Gene name Functional description O.I. H.G. Other DB
XAt1g01040839574DCL1 (DICER-LIKE 1)Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.O.I.H.G.
XAt1g09700837498HYL1 (HYPONASTIC LEAVES 1)Encodes a nuclear dsRNA binding protein. Involved in mRNA cleavage. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin.O.I.H.G.
XAt2g398855007946MIR393AEncodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are F-box proteins and bHLH transcription factor.O.I.H.G.
XAt2g466853768747MIR166/MIR166AEncodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCCO.I.H.G.
XAt2g475853768750MIR164/MIR164AEncodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCAO.I.H.G.
XAt4g20910827839HEN1 (HUA ENHANCER 1)Encodes an enhancer of hua1 and hua2 tha acts to specify reproductive organ identities and to repress A gene function. HEN1 also shares AG's non-homeotic function in controlling floral determinacy. Mutants display corymb-like inflorescences. HEN1 is a methyltransferase that methylates miRNAs and siRNAs on the ribose of the last nucleotide. The 3'-end methylation probably protects the 3' ends of the small RNAs from uridylation.O.I.H.G.



The upper GO terms

Process ID Gene number Process name
GO:00063793Any process by which a pre-mRNA or mRNA molecule is cleaved at specific sites or in a regulated manner.
GO:003519556Downregulation of gene expression through the action of microRNAs (miRNAs), endogenous 21-24 nucleotide small RNAs processed from stem-loop RNA precursors (pre-miRNAs). Once incorporated into a RNA-induced silencing complex (RISC), miRNAs can downregulate gene expression by either of two posttranscriptional mechanisms: mRNA cleavage or translational repression.



The lower GO terms

Process ID Gene number Process name





Comparison with co-expressed genes



Back to the CoP portal site

Back to the KAGIANA project homepage