Biological process to genes

Query process ID GO:0016481
Process name Any process that stops, prevents or reduces the frequency, rate or extent of transcription.
Organism Arabidopsis thaliana

Click Gene ID to show a list of co-expressed genes.

ECC Gene ID Repr. ID Gene name Functional description O.I. H.G. Other DB
XAt1g02450837800NIMIN1 (NIM1-INTERACTING 1)NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression.O.I.H.G.
XAt1g02580839422MEA (MEDEA)Encodes a putative transcription factor MEDEA (MEA) that negatively regulates seed development in the absence of fertilization. Mutations in this locus result in embryo lethality. MEA is a Polycomb group gene that is imprinted in the endosperm. The maternal allele is expressed and the paternal allele is silent. MEA is controlled by DEMETER (DME), a DNA glycosylase required to activate MEA expression, and METHYLTRANSFERASE I (MET1), which maintains CG methylation at the MEA locus. MEA is involved in the negative regulation of its own imprinted gene expression; the effect is not only allele-specific but also dynamically regulated during seed development. In the ovule, the MEA transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilizationO.I.H.G.
XAt1g24190839032SNL3 (SIN3-LIKE 3)Enhances AtERF7-mediated transcriptional repression. RNAi lines show ABA hypersensitivity. Interacts with ERF7 and HDA19.O.I.H.G.
XAt1g59750842268ARF1 (AUXIN RESPONSE FACTOR 1)Encodes a member of the auxin response factor family. ARFs bind to the cis element 5'-TGTCTC-3' ARFs mediate changes in gene expression in response to auxin. ARF's form heterodimers with IAA/AUX genes. ARF1 enhances mutant phenotypes of ARF2 and may act with ARF2 to control aspects of maturation and senescence.ARF1:LUC and 3xHA:ARF1 proteins have a half-life of ~3-4 hours and their degradation is reduced by proteasome inhibitors. 3xHA:ARF1 degradation is not affected by a pre-treatment with IAA. A nuclear-targeted fusion protein containing the middle region of ARF1 linked to LUC:NLS has a similar half-life to the full-length ARF1:LUC construct. The degradation of 3xHA:ARF1 is not affected in an axr6-3 mutant grown at room temperature, although the degradation of AXR2/IAA7 is slowed under these conditions.O.I.H.G.
XAt2g22540816787SVP (SHORT VEGETATIVE PHASE)Encodes a nuclear protein that acts as a floral repressor and that functions within the thermosensory pathway. SVP represses FT expression via direct binding to the vCArG III motif in the FT promoter.O.I.H.G.
XAt2g25170817055PKL (PICKLE)Encodes a SWI/SWF nuclear-localized chromatin remodeling factor of the CHD3 group. Involved in post-germination repression of embryonic development. Acts with GA to establish repression of embryonic genes upon germination. Protein preferentially accumulates in differentiating tissues. Loss of function alleles are associated with expression of embryonic traits in adult plants and derepression of embryonic genes such as PHEROS1. Is an extragenic suppressor of slr2 (SSL2). Mutations in PKL (SSL2) restores lateral root formation in the slr2 mutant slr-1. It was proposed that PKL/SSL2-mediated chromatin remodeling negatively regulates auxin-mediated LR formation in Arabidopsis.O.I.H.G.
XAt2g32700817830WD-40 repeat family proteinEncodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG.O.I.H.G.
XAt2g37630818340AS1 (ASYMMETRIC LEAVES 1)Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP.O.I.H.G.
XAt2g39810818568HOS1A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses. Functions as an E3 ligase required for the ubiquitination of ICE1. HOS1 physically interacts with ICE1 and mediates the ubiquitination of ICE1 both in vitro and in vivo. Overexpression represses the expression of CBFs and their downstream genes and confers increased sensitivity to freezing stress.O.I.H.G.
XAt2g475853768750MIR164/MIR164AEncodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCAO.I.H.G.
XAt3g02000820200ROXY1Roxy1 encodes a glutaredoxin belonging to a subgroup specific to higher plants. It is required for proper petal initiation and organogenesis. It is likely to function in the temporal and spatial expression regulation of AGAMOUS in the first and second whorl. It's function is dependent on the Cysteine 49 residue and its nuclear localization. ROXY1 interacts in vitro and in vivo with members of the TGA family of transcription factors (e.g. TGA2, TGA3, TGA7 and PAN).O.I.H.G.
XAt3g23130821888SUP (SUPERMAN)Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors.O.I.H.G.
XAt4g05420825890DDB1A (DAMAGED DNA BINDING PROTEIN 1A)Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis.O.I.H.G.
XAt4g15900827272PRL1 (PLEIOTROPIC REGULATORY LOCUS 1)Mutations confer hypersensitivity to glucose and sucrose and augments sensitivity to cytokinin, ethylene, ABA and auxin. Encodes a nuclear WD40 protein that is imported into the nucleus. Essential for plant innate immunity. Interacts with MOS4 and AtCDC5. It is also predicted to have two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase, and may affect the stability of AKIN10.O.I.H.G.
XAt4g16780827384ATHB-2 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 2)Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin.O.I.H.G.
XAt4g21670828254CPL1 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 1)encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl.O.I.H.G.
XAt4g28110828927AtMYB41 (myb domain protein 41)Member of the R2R3 factor gene family. Expression is induced in response to dessication, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion.O.I.H.G.
XAt4g32551829390LUG (LEUNIG)LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors.O.I.H.G.
XAt4g38130829969HD1 (HISTONE DEACETYLASE 1)Encodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation.O.I.H.G.
XAt4g38620830018MYB4Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2.O.I.H.G.
XAt5g017473770673MIR164/MIR164BEncodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCAO.I.H.G.
XAt5g02030831745RPL (REPLUMLESS)Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP.O.I.H.G.
XAt5g08550830755ILP1 (increased level of polyploidy1-1D)Encodes a transcriptional repressor that is homologous to the C-terminal region of mammalian GC binding factor. It regulates endoreduplication through control of CYC2A expression.O.I.H.G.
XAt5g14070831256ROXY2Encodes glutaredoxin ROXY2. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen.O.I.H.G.
XAt5g22650832328HD2B (HISTONE DEACETYLASE 2B)Encodes a member of a plant-specific class of histone deacetylases. Controls the development of adaxial/abaxial leaf polarity. Its mRNA is widely expressed in stems, leaves, flowers and young siliques. Plant lines expressing RNAi constructs directed against this gene showed a marked reduction in agrobacterium-mediated root transformation.O.I.H.G.
XAt5g278073770751MIR164/MIR164CEncodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1)O.I.H.G.
XAt5g62430836364CDF1 (CYCLING DOF FACTOR 1)Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon.O.I.H.G.
XAt5g63980836519SAL1Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration due to higher accumulation of the second messenger, inositol (1,4,5)- triphosphate (IP(3)). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity.O.I.H.G.
SAt4g37460829901SRFR1 (SUPPRESSOR OF RPS4-RLD 1)Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms.Involved in mediating effector-triggered immunity.O.I.H.G.
CAt5g18230831941transcription regulator NOT2/NOT3/NOT5 family proteinF:transcription regulator activity;P:negative regulation of transcription, regulation of transcription;C:nucleus;MOFBPVAO.I.H.G.
CAt5g59710836092VIP2 (VIRE2 INTERACTING PROTEIN2)Encodes a nuclear-localized NOT (negative on TATA-less) domain-containing protein that interacts with the Agrobacterium VirE2 protein and is required for Agrobacterium-mediated plant transformation. It likely facilitates T-DNA integration into plant chromosomes and may play a role as a transcriptional regulator.O.I.H.G.
LAt4g27270828835quinone reductase family proteinF:oxidoreductase activity, FMN binding;P:negative regulation of transcription;C:plasma membrane;BOFPAMVO.I.H.G.
LAt4g36750829828quinone reductase family proteinF:oxidoreductase activity, FMN binding;P:negative regulation of transcription;C:plasma membrane;BOFPAMVO.I.H.G.
LAt5g58800835997quinone reductase family proteinF:oxidoreductase activity, FMN binding;P:negative regulation of transcription;C:plasma membrane;BOFPAMVO.I.H.G.



The upper GO terms

Process ID Gene number Process name
GO:00105580Any process that decreases the rate, frequency or extent of the chemical reactions and pathways resulting in the formation of a macromolecule, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass.
GO:00106290Any process that decreases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA (for protein-coding genes) and the translation of that mRNA into protein. Some protein processing events may be included when they are required to form an active form of a product from an inactive precursor form.
GO:00313270Any process that stops, prevents or reduces the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of substances, carried out by individual cells.
GO:00454490Any process that modulates the frequency, rate or extent of the synthesis of either RNA on a template of DNA or DNA on a template of RNA.
GO:00459340Any process that stops, prevents or reduces the frequency, rate or extent of the chemical reactions and pathways involving nucleobases, nucleosides, nucleotides and nucleic acids.



The lower GO terms

Process ID Gene number Process name
GO:00106780Any cellular process that decreases the rate, extent or frequency of the chemical reactions and pathways involving carbohydrates carried out by repression of transcription.
GO:00458921Any process that stops, prevents or reduces the frequency, rate or extent of DNA-dependent transcription.
GO:00751820Any process by which an organism stops, prevents or reduces the frequency, rate or extent of its transcription as a result of detecting molecules of its host organism. The host is defined as the larger of the organisms involved in a symbiotic interaction.





Comparison with co-expressed genes



Back to the CoP portal site

Back to the KAGIANA project homepage