Biological process to genes

Query process ID GO:0016036
Process name A change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of phosphate.
Organism Arabidopsis thaliana

Click Gene ID to show a list of co-expressed genes.

ECC Gene ID Repr. ID Gene name Functional description O.I. H.G. Other DB
XAt1g13300837890myb family transcription factorF:transcription factor activity, DNA binding;P:regulation of transcription;C:unknown;POVBMFO.I.H.G.
XAt1g20620838651CAT3 (CATALASE 3)Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.O.I.H.G.
XAt1g20630838652CAT1 (CATALASE 1)Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2.O.I.H.G.
XAt1g23010838909LPR1 (Low Phosphate Root1)Encodes a protein with multicopper oxidase activity.O.I.H.G.
XAt1g55180841961PLDEPSILON (PHOSPHOLIPASE D ALPHA 4)member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties.O.I.H.G.
XAt1g630055007833MIR399BEncodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CCUGCCAAAGGAGAGUUGCCCO.I.H.G.
XAt1g68740843205EXS family protein / ERD1/XPR1/SYG1 family proteinEncodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation.O.I.H.G.
XAt1g71040843444LPR2 (Low Phosphate Root2)F:oxidoreductase activity, copper ion binding;P:cellular response to phosphate starvation;C:cell wall, membrane;BPOFMAO.I.H.G.
XAt2g02990814828RNS1 (RIBONUCLEASE 1)member of the ribonuclease T2 family, responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid.O.I.H.G.
XAt2g11810815657MGDCMGD3 is the major enzyme for galactolipid metabolism during phosphate starvation. Does not contribute to galactolipid synthesis under P1-sufficient conditions.O.I.H.G.
XAt2g26660817207SPX2 (SPX DOMAIN GENE 2)F:molecular_function unknown;P:cellular response to phosphate starvation;C:nucleus;FMPOBO.I.H.G.
XAt2g27190817261PAP12 (PURPLE ACID PHOSPHATASE 12)secreted purple acid phosphatase precursorO.I.H.G.
XAt2g33770817943PHO2 (PHOSPHATE 2)Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response.O.I.H.G.
XAt2g342025007928MIR399DEncodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAUUUGCCCCGO.I.H.G.
XAt2g342085007930MIR399FEncodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAUUUGCCCGGO.I.H.G.
XAt2g45130819120SPX3 (SPX DOMAIN GENE 3)F:molecular_function unknown;P:cellular response to phosphate starvation, positive regulation of cellular response to phosphate starvation;C:cellular_component unknown;FMPOO.I.H.G.
XAt3g03250821313UGP (UDP-glucose pyrophosphorylase)Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding.O.I.H.G.
XAt3g03540821241NPC5 (NON-SPECIFIC PHOSPHOLIPASE C5)Encodes a nonspecific phospholipase C. Located in the cytosol. Involved in the conversion of phospholipids to glycolipids under phosphate deprivation conditions.O.I.H.G.
XAt3g05630819730PLDP2Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning.O.I.H.G.
XAt3g09922820152IPS1 (INDUCED BY PHOSPHATE STARVATION1)AF236376 Arabidopsis thaliana IPS1 mRNA, complete sequenceO.I.H.G.
XAt3g16785820932PLDP1 (PHOSPHOLIPASE D P1)Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation.O.I.H.G.
XAt3g23430821924PHO1 (phosphate 1)mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. encodes protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains.O.I.H.G.
XAt3g52190824384PHF1 (PHOSPHATE TRANSPORTER TRAFFIC FACILITATOR1)Encodes a plant specific protein structurally related to the SEC12 proteins of the early secretory pathway. Mutation of PHF1 impairs Pi transport. Expression was detected in all tissues, and was induced by Pi starvation. Localized in endoplasmic reticulum (ER), and mutation of PHF1 resulted in ER retention and reduced accumulation of the plasma membrane PHT1;1 transporter.O.I.H.G.
XAt3g62980825473TIR1 (TRANSPORT INHIBITOR RESPONSE 1)Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation.O.I.H.G.
XAt4g00550827960DGD2encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane.O.I.H.G.
XAt4g28610828979PHR1 (PHOSPHATE STARVATION RESPONSE 1)Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling.O.I.H.G.
XAt4g33030829440SQD1involved in sulfolipid biosynthesisO.I.H.G.
XAt4g35090829661CAT2 (CATALASE 2)Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2).O.I.H.G.
XAt5g01220831888SQD2 (sulfoquinovosyldiacylglycerol 2)involved in sulfolipid biosynthesisO.I.H.G.
XAt5g15330831385SPX4 (SPX DOMAIN GENE 4)F:molecular_function unknown;P:cellular response to phosphate starvation;C:cellular_component unknown;FMPOO.I.H.G.
XAt5g20150832137SPX1 (SPX DOMAIN GENE 1)F:molecular_function unknown;P:cellular response to phosphate starvation, positive regulation of cellular response to phosphate starvation;C:nucleus;FMPOBAO.I.H.G.
XAt5g20410832163MGD2Encodes a type B monogalactosyldiacylglycerol (MGDG) synthase. Strongly induced by phosphate deprivation, and in non-photosynthetic tissues. Does not contribute to galactolipid synthesis under Pi-sufficient conditions but does under Pi starvation.O.I.H.G.
XAt5g21040832228FBX2 (F-BOX PROTEIN 2)Encodes an F-box containing protein that interacts physically with BHLH32 and appears to be involved in mediating phosphate starvation responses.O.I.H.G.
XAt5g23630832428ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase familiy proteinA novel member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure.O.I.H.G.
XAt5g43350834353PHT1Encodes an inorganic phosphate transporter. Mutants display enhanced arsenic accumulation.O.I.H.G.
XAt5g621625008323MIR399CEncodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUGO.I.H.G.
SAt1g66270842944BGLU21F:cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity;P:cellular response to phosphate starvation, response to salt stress;C:vacuole, membrane;BOPMFAO.I.H.G.



The upper GO terms

Process ID Gene number Process name
GO:00092674A change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nourishment.



The lower GO terms

Process ID Gene number Process name





Comparison with co-expressed genes



Back to the CoP portal site

Back to the KAGIANA project homepage