Biological process to genes

Query process ID GO:0009738
Process name A series of molecular signals mediated by the detection of abscisic acid.
Organism Arabidopsis thaliana

Click Gene ID to show a list of co-expressed genes.

ECC Gene ID Repr. ID Gene name Functional description O.I. H.G. Other DB
XAt1g15080838072LPP2 (LIPID PHOSPHATE PHOSPHATASE 2)Encodes phosphatidic acid phosphatase. Involved in ABA signaling. Functions as a negative regulator upstream of ABI4. Expressed during germination and seed development. Expressed overall in young seedlings, in roots, hypocotyls, and vascular cells of cotyledons and leaves of 10 day-old seedlings, in flower filaments and stem elongation zones. Not expressed in anthers, pollen nor petals.O.I.H.G.
XAt1g45249841095ABF2 (ABSCISIC ACID RESPONSIVE ELEMENTS-BINDING FACTOR 2)Leucine zipper transcription factor that binds to the abscisic acid (ABA)–responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment.O.I.H.G.
XAt1g69270843258RPK1 (RECEPTOR-LIKE PROTEIN KINASE 1)RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1.O.I.H.G.
XAt2g17290816235CPK6 (CALCIUM-DEPENDENT PROTEIN KINASE 6)Encodes calcium dependent protein kinase 6 (CPK6), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK6 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK3 is also a member of the Arabidopsis CDPK family.O.I.H.G.
XAt2g28350817382ARF10 (AUXIN RESPONSE FACTOR 10)Involved in root cap cell differentiation.O.I.H.G.
XAt2g391753768181MIR160/MIR160AEncodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCAO.I.H.G.
XAt2g40220818614ABI4 (ABA INSENSITIVE 4)encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Expressed most abundantly in developing siliques and to a lesser degree in seedlings.O.I.H.G.
XAt2g43350818936ATGPX3 (GLUTATHIONE PEROXIDASE 3)Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1.O.I.H.G.
XAt2g46680819280ATHB-7 (ARABIDOPSIS THALIANA HOMEOBOX 7)encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response.O.I.H.G.
XAt3g11410820314PP2CA (ARABIDOPSIS THALIANA PROTEIN PHOSPHATASE 2CA)Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA.O.I.H.G.
XAt3g19290821463ABF4 (ABRE BINDING FACTOR 4)bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediate ABA-dependent stress responses.O.I.H.G.
XAt3g57530824920CPK32 (CALCIUM-DEPENDENT PROTEIN KINASE 32)Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitroO.I.H.G.
XAt4g177883770127MIR160/MIR160BEncodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCAO.I.H.G.
XAt4g17870827510-F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.H.G.
XAt4g21670828254CPL1 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 1)encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl.O.I.H.G.
XAt4g23650828465CDPK6 (CALCIUM-DEPENDENT PROTEIN KINASE 6)Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family.O.I.H.G.
XAt4g34000829547ABF3 (ABSCISIC ACID RESPONSIVE ELEMENTS-BINDING FACTOR 3)Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid.O.I.H.G.
XAt5g01540831722LECRKA4.1 (LECTIN RECEPTOR KINASE A4.1)Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination.O.I.H.G.
XAt5g01550831700LECRKA4.2 (LECTIN RECEPTOR KINASE A4.1)Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination.O.I.H.G.
XAt5g01560830345LECRKA4.3 (LECTIN RECEPTOR KINASE A4.3)Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination.O.I.H.G.
XAt5g13530831197KEG (KEEP ON GOING)Encodes KEEP ON GOING (KEG), a RING E3 ligase involved in abscisic acid signaling. KEG is essential for Arabidopsis growth and development.O.I.H.G.
XAt5g468453771452MIR160/MIR160C (MICRORNA160)Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCAO.I.H.G.
XAt5g52300835306LTI65 (LOW-TEMPERATURE-INDUCED 65)encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi.O.I.H.G.
XAt5g53160835397unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PO.I.H.G.
XAt5g63980836519SAL1Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration due to higher accumulation of the second messenger, inositol (1,4,5)- triphosphate (IP(3)). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity.O.I.H.G.
SAt1g18890838470ATCDPK1 (CALCIUM-DEPENDENT PROTEIN KINASE 1)encodes a calcium-dependent protein kinase whose gene expression is induced by dehydration and high salt. Kinase activity could not be detected in vitro.O.I.H.G.
SAt1g25490839135RCN1 (ROOTS CURL IN NPA)One of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stemO.I.H.G.
SAt1g49720841395ABF1 (ABSCISIC ACID RESPONSIVE ELEMENT-BINDING FACTOR 1)Identified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses.O.I.H.G.
SAt1g64060842710ATRBOH F (ARABIDOPSIS THALIANA RESPIRATORY BURST OXIDASE PROTEIN F)Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site.O.I.H.G.
SAt1g69260843257AFP1 (ABI FIVE BINDING PROTEIN)F:unknown;P:abscisic acid mediated signaling;C:nucleus;POMFO.I.H.G.
SAt1g74740843813CPK30 (CALCIUM-DEPENDENT PROTEIN KINASE 30)member of Calcium Dependent Protein KinaseO.I.H.G.
SAt2g17800816290ARAC1A member of ROP GTPase family. Rac-like GTP-binding protein ARAC1/ATGP2. Encodes a geranylgeranylated GTP binding protein. Involved in the auxin-activated 26S proteasome-dependent Aux/IAA proteolysis pathway.O.I.H.G.
SAt2g22430816775ATHB6Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis.O.I.H.G.
SAt2g26300817170GP ALPHA 1 (G PROTEIN ALPHA SUBUNIT 1)Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling.O.I.H.G.
SAt2g26980817240CIPK3 (CBL-INTERACTING PROTEIN KINASE 3)encodes a serine-threonine protein kinase whose expression increases in response to abscisic acid, cold, drought, high salt, and wounding conditions. The gene is expressed in developing seeds and seedlings. Lines carrying a T-DNA insertions have reduced germination efficiency and expression of cold, high-salt, and abscisic acid marker genes are altered, but not drought-response markers.O.I.H.G.
SAt2g41070818706EEL (ENHANCED EM LEVEL)Transcription factor homologous to ABI5. Regulates AtEm1 expression by binding directly at the AtEm1 promoter. Located in the nucleus and expressed during seed maturation in the cotyledons and later in the whole embryo.O.I.H.G.
SAt3g45640823706ATMPK3 (ARABIDOPSIS THALIANA MITOGEN-ACTIVATED PROTEIN KINASE 3)Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro.O.I.H.G.
SAt3g48040823959ROP10 (RHO-RELATED PROTEIN FROM PLANTS 10)Encodes a member of the Rop subfamily of Rho GTPases in Arabidopsis that contains a putative farnesylation motif. It is localized to the plasma membrane and involved in the negative regulation of ABA signalling.O.I.H.G.
SAt3g56860824853UBP1 interacting protein 2a (UBA2a)encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.O.I.H.G.
SAt4g17615827481CBL1 (CALCINEURIN B-LIKE PROTEIN 1)Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation.O.I.H.G.
SAt4g33950829541OST1 (OPEN STOMATA 1)Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network.O.I.H.G.
SAt5g01810830556CIPK15 (CBL-INTERACTING PROTEIN KINASE 15)Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase.O.I.H.G.
SAt5g58670835981PLC1 (PHOSPHOLIPASE C 1)phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one).O.I.H.G.
SAt5g65310836656ATHB5 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 5)Encodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment.O.I.H.G.
SAt5g66880836822SNRK2.3 (SUCROSE NONFERMENTING 1(SNF1)-RELATED PROTEIN KINASE 2.3)encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth.O.I.H.G.



The upper GO terms

Process ID Gene number Process name
GO:00097370A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an abscisic acid stimulus.
GO:00097554A series of molecular signals mediated by the detection of a hormone.



The lower GO terms

Process ID Gene number Process name





Comparison with co-expressed genes



Back to the CoP portal site

Back to the KAGIANA project homepage