Biological process to genes

Query process ID GO:0009734
Process name The series of molecular signals generated in response to detection of auxin.
Organism Arabidopsis thaliana

Click Gene ID to show a list of co-expressed genes.

ECC Gene ID Repr. ID Gene name Functional description O.I. H.G. Other DB
XAt1g05180839286AXR1 (AUXIN RESISTANT 1)Encodes a subunit of the RUB1 activating enzyme that regulates the protein degradation activity of Skp1-Cullin-Fbox complexes, primarily, but not exclusively, affecting auxin responses. Acts alongside AS1 to exclude BP expression from leaves.O.I.H.G.
XAt1g14000837960VIK (VH1-INTERACTING KINASE)Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling.O.I.H.G.
XAt1g16540838224ABA3 (ABA DEFICIENT 3)Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.O.I.H.G.
XAt1g31880840078BRX (BREVIS RADIX)Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. BRX encodes a key regulator of cell proliferation and elongation in the root, which has been implicated in the brassinosteroid (BR) pathway as well as regulation of auxin-responsive gene expression. Also involved in cytokinin-mediated inhibition of lateral root initiation. A loss-of-function allele, named brx-2 in Rodrigues et al. (2009) Plant Physiol. but changed to brx-3 to resolve nomenclature conflict (Li et al. Planta 2009:229(3):593-603), shows enhanced response to ABA-mediated inhibition of root growth.O.I.H.G.
XAt2g01950814726BRL2 (BRI1-LIKE 2)Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein.O.I.H.G.
XAt2g17800816290ARAC1A member of ROP GTPase family. Rac-like GTP-binding protein ARAC1/ATGP2. Encodes a geranylgeranylated GTP binding protein. Involved in the auxin-activated 26S proteasome-dependent Aux/IAA proteolysis pathway.O.I.H.G.
XAt2g20120816531COV1 (CONTINUOUS VASCULAR RING)Encodes an integral membrane protein of unknown function, highly conserved between plants and bacteria; is likely to be involved in a mechanism that negatively regulates the differentiation of vascular tissue in the stem. Mutants display a dramatic increase in vascular tissue development in the stem in place of the interfascicular region that normally separates the vascular bundles.O.I.H.G.
XAt2g28350817382ARF10 (AUXIN RESPONSE FACTOR 10)Involved in root cap cell differentiation.O.I.H.G.
XAt2g34650818030PID (PINOID)Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID.O.I.H.G.
XAt2g391753768181MIR160/MIR160AEncodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCAO.I.H.G.
XAt2g42580818858TTL3 (TETRATRICOPETIDE-REPEAT THIOREDOXIN-LIKE 3)Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling.O.I.H.G.
XAt3g28970822537AAR3 (antiauxin-resistant 3)Identified in a screen for mutants resistant to an anti-auxin. Encodes a protein with unknown function that shares homology with DCN protein family.O.I.H.G.
XAt3g53020824468STV1 (SHORT VALVE1)RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20.O.I.H.G.
XAt3g62980825473TIR1 (TRANSPORT INHIBITOR RESPONSE 1)Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation.O.I.H.G.
XAt4g10100826601CNX7molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.O.I.H.G.
XAt4g11260826728SGT1BFunctions in plant disease resistance signaling, SCF(TIR1) mediated degradation of Aux/IAA proteins and HSP90 mediated degradation of R resistance proteins. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance.O.I.H.G.
XAt4g177883770127MIR160/MIR160BEncodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCAO.I.H.G.
XAt4g37580829913HLS1 (HOOKLESS 1)involved in apical hook development. putative N-acetyltransferaseO.I.H.G.
XAt5g01270831743CPL2Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses.O.I.H.G.
XAt5g20990832224B73Involved in molybdenum cofactor (Moco) biosynthesis, inserting Mo into Molybdopterin. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.O.I.H.G.
XAt5g23080832372TGH (TOUGH)Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.O.I.H.G.
XAt5g468453771452MIR160/MIR160C (MICRORNA160)Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCAO.I.H.G.
XAt5g47370834784HAT2homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis.O.I.H.G.
XAt5g54510835539DFL1 (DWARF IN LIGHT 1)Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3).O.I.H.G.
XAt5g63310836451NDPK2 (NUCLEOSIDE DIPHOSPHATE KINASE 2)Maintains intracellular dNTP levels except ATP. Plays a role in response to oxidative stress and UV. Involved in phytochrome-mediated light signaling. Participates in auxin-regulated processes, partly through the modulation of auxin transport. H-bonding with His-197 inside the nucleotide-binding pocket is critical for NDPK2 functioning.O.I.H.G.
SAt1g04250839568AXR3 (AUXIN RESISTANT 3)Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.O.I.H.G.
SAt1g10210837559ATMPK1 (MITOGEN-ACTIVATED PROTEIN KINASE 1)Encodes ATMPK1.O.I.H.G.
SAt1g56010842052NAC1Encodes a transcription factor involved in shoot apical meristem formation and auxin-mediated lateral root formation. The gene is thought not to be involved in stress responses (NaCl, auxins, ethylene). NAC1 (NAC1)O.I.H.G.
SAt1g77850844120ARF17 (AUXIN RESPONSE FACTOR 17)Posttranscriptionally regulated by miR160 and is essential for proper development.Regulates early auxin response genes.O.I.H.G.
SAt5g65670836693IAA9 (INDOLE-3-ACETIC ACID INDUCIBLE 9)auxin (indole-3-acetic acid) induced geneO.I.H.G.
CAt2g32410817802AXL (AXR1-LIKE)F:binding, catalytic activity;P:auxin homeostasis, post-embryonic development, auxin mediated signaling pathway, protein ubiquitination;C:peroxisome;BOMFPAO.I.H.G.
NAt2g398855007946MIR393AEncodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are F-box proteins and bHLH transcription factor.O.I.H.G.



The upper GO terms

Process ID Gene number Process name
GO:00097330A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an auxin stimulus.
GO:00097554A series of molecular signals mediated by the detection of a hormone.



The lower GO terms

Process ID Gene number Process name
GO:00103152The process involved in the transport of auxin out of the cell.
GO:00607740The series of molecular signals generated in response to detection of auxin that contributes to the radial pattern formation process resulting in the formation of leaf or flower primordia around the center of a shoot apical meristem.
GO:00900150Any process that increases the frequency, rate or extent of leaflet formation as a result of the series of molecular signals generated in response to detection of auxin.





Comparison with co-expressed genes



Back to the CoP portal site

Back to the KAGIANA project homepage