CoP: Co-expressed Biological Processes

Gene omics information

Query gene ID At5g09690

Gene name magnesium transporter CorA-like family protein (MRS2-7)

Organism Arabidopsis thaliana

Co-expressed genes

As this page just shows up to 10 genes to the query, if you wish to have the complete list of co-expressed genes, click Gene/Probe ID.

VF %ile Gene/Probe ID Repr.ID Gene Name Functional Description S.X. H.G. Other DB
0.27 26.2 At5g09690 830828 magnesium transporter CorA-like family protein (MRS2-7) F:metal ion transmembrane transporter activity;P:metal ion transport;C:membrane;PFOMB S.X. H.G.
0.43 55.3 At4g14290 827070 - F:unknown;P:unknown;C:plasma membrane;OBMFPVA S.X. H.G.
0.33 38.1 At4g17960 827521 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P S.X. H.G.
0.29 30.3 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA S.X. H.G.
0.15 7.8 At3g47910 823946 ubiquitin thiolesterase/ zinc ion binding F:ubiquitin thiolesterase activity, zinc ion binding;P:ubiquitin-dependent protein catabolic process;C:intracellular;MOFPBAV S.X. H.G.
Click here to hide the above table.

Specifically expressed experiments

As this page just shows up to 10 assays to the query, if you wish to have the complete list of assays that the query gene/probe was specifically expressed, click here.
Std2 GX %ile GSM ID Assay Name GSE ID Experiment Title
97.8 99.9 E-MEXP-509-raw-cel-829148525
96.2 99.9 E-MEXP-509-raw-cel-829148561
85.7 99.9 E-MEXP-509-raw-cel-829148456
81.7 99.9 E-MEXP-509-raw-cel-829148348
61.3 99.8 GSM184556 Whole roots 2hr KNO3 treated then incubated in protoplast-generating solution minus enzymes, biological rep2 GSE7631 Cell-specific nitrogen responses in the Arabidopsis root
60.3 99.8 GSM143306 High_Na_seg_pool_tsu_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1
55.7 99.8 GSM143310 Tsu_genomic_hyb_1 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1
55.1 99.8 GSM143309 Tsu_genomic_hyb_2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1
52.8 99.8 E-ATMX-35-raw-cel-1574334832
51.9 99.8 E-MEXP-509-raw-cel-829148420
Click here to hide the above table.

Homologous genes

Paralogous genes

Click Gene ID to show a list of homologous genes.

HF Ev BS Gene ID Repr. ID Gene Name Functional description C.G. S.X. Other DB
0.63 1e-78 293 At5g09720 830831 metal ion transmembrane transporter F:metal ion transmembrane transporter activity;P:metal ion transport;C:membrane;PFMO C.G. S.X.
0.63 1e-72 274 At5g64560 836577 magnesium transporter CorA-like family protein (MRS2-2) F:metal ion transmembrane transporter activity;P:metal ion transport;C:membrane;PFOMB C.G. S.X.
0.37 4e-39 163 At5g09710 830830 magnesium transporter CorA-like family protein F:metal ion transmembrane transporter activity;P:metal ion transport;C:membrane;PFMO C.G. S.X.
0.03 6e-7 56 At4g28580 828976 magnesium transporter CorA-like family protein (MRS2-6) F:metal ion transmembrane transporter activity;P:metal ion transport;C:membrane;PFOMB C.G. S.X.
0.02 4e-2 40 At1g22330 838839 RNA binding / nucleic acid binding / nucleotide binding F:RNA binding, nucleotide binding, nucleic acid binding;P:biological_process unknown;C:cellular_component unknown;MPFOBA C.G. S.X.
Click here to hide the above table.

Orthologous genes

Click Gene ID to show a list of orthologous genes.

HF Ev BS Species Gene ID Repr. ID Gene Name Functional description Ev AGI code Arabidopsis gene name C.G. S.X. Other DB
0.44 5e-42 173 Glycine max GmaAffx.75679.1.S1_at BU577998 - - 2e-42 At5g09690 magnesium transporter CorA-like family protein (MRS2-7) C.G. S.X.
0.24 9e-17 87 Hordeum vulgare Contig7374_at Contig7374 - - 2e-25 At5g64560 magnesium transporter CorA-like family protein (MRS2-2) C.G. S.X.
0.34 1e-21 105 Oryza sativa Os03g0742400 AK060249.1 - MRS2-7 6e-26 At5g64560 magnesium transporter CorA-like family protein (MRS2-2) C.G. S.X.
0.40 5e-42 173 Populus trichocarpa PtpAffx.208738.1.S1_s_at pmrna17323 magnesium transporter - 8e-47 At5g64560 magnesium transporter CorA-like family protein (MRS2-2) C.G. S.X.
0.19 1e-17 91 Triticum aestivum Ta.5678.1.S1_at BJ309797 - - 1e-21 At5g64560 magnesium transporter CorA-like family protein (MRS2-2) C.G. S.X.
0.23 5e-17 87 Vitis vinifera 1607916_at CF515316 hypothetical protein LOC100246066 - 5e-35 At5g64560 magnesium transporter CorA-like family protein (MRS2-2) C.G. S.X.
0.08 2e-8 59 Zea mays Zm.3197.1.A1_at BG840819 metal ion transporter - 4e-9 At5g64560 magnesium transporter CorA-like family protein (MRS2-2) C.G. S.X.
Click here to hide the above table.

Biological processes

Click GO ID to show a list of genes that are associated with the GO ID.

ECC GO ID Process Name
C GO:0030001 The directed movement of metal ions, any metal ion with an electric charge, into, out of, within or between cells.
Click here to hide the above table.

Metabolic pathways

Click KaPPA-View ID to show a list of genes that are assigned to the KaPPA-View ID.

KaPPA-View ID Link to Kappa-View Pathway Name

Click KEGG PATHWAY ID to show a list of genes that are assigned to the KEGG PATHWAY ID.

KEGG PATHWAY ID Link to KEGG PATHWAY Pathway Name
Click here to hide the above table.

Back to the CoP portal site

Back to the KAGIANA project homepage