CoP: Co-expressed Biological Processes

Gene omics information

Query gene ID At3g03120

Gene name ATARFB1C (ADP-ribosylation factor B1C)

Organism Arabidopsis thaliana

Co-expressed genes

As this page just shows up to 10 genes to the query, if you wish to have the complete list of co-expressed genes, click Gene/Probe ID.

VF %ile Gene/Probe ID Repr.ID Gene Name Functional Description S.X. H.G. Other DB
0.50 65.3 At3g03120 821079 ATARFB1C (ADP-ribosylation factor B1C) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. S.X. H.G.
0.75 86.9 At5g40920 3771388 - F:unknown;P:unknown;C:unknown S.X. H.G.
0.60 75.7 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA S.X. H.G.
0.50 65.3 At3g05080 819670 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P S.X. H.G.
0.50 65.3 At4g17960 827521 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P S.X. H.G.
0.38 46.7 At4g31030 829230 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P S.X. H.G.
Click here to hide the above table.

Specifically expressed experiments

As this page just shows up to 10 assays to the query, if you wish to have the complete list of assays that the query gene/probe was specifically expressed, click here.
Std2 GX %ile GSM ID Assay Name GSE ID Experiment Title
215.6 100.0 E-MEXP-509-raw-cel-829148561
170.0 100.0 E-MEXP-509-raw-cel-829148525
136.6 99.9 E-MEXP-509-raw-cel-829148597
117.8 99.9 E-MEXP-509-raw-cel-829148456
112.7 99.9 E-MEXP-509-raw-cel-829148348
98.3 99.9 E-MEXP-509-raw-cel-829148201
91.9 99.9 E-MEXP-509-raw-cel-829148420
85.0 99.9 E-MEXP-509-raw-cel-829148165
83.3 99.9 E-MEXP-509-raw-cel-829148492
72.8 99.9 E-MEXP-509-raw-cel-829148313
Click here to hide the above table.

Homologous genes

Paralogous genes

Click Gene ID to show a list of homologous genes.

HF Ev BS Gene ID Repr. ID Gene Name Functional description C.G. S.X. Other DB
0.88 4e-173 607 At5g17060 831569 ATARFB1B A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster), other ARFs and ARF-like proteins. C.G. S.X.
0.10 3e-4 46 At1g10630 837606 ATARFA1F (ARABIDOPSIS THALIANA ADP-RIBOSYLATION FACTOR A1F) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. C.G. S.X.
0.14 1e-3 44 At5g14670 831319 ATARFA1B (ADP-ribosylation factor A1B) A member of ARF GTPase family. Arabidopsis has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor DcARF1 (GI:965483) (Daucus carota), other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. C.G. S.X.
0.16 1e-3 44 At1g23490 838957 ATARF1 (ADP-RIBOSYLATION FACTOR 1) Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. C.G. S.X.
0.03 2e-2 40 At4g05000 825842 VPS28-2 F:transporter activity;P:transport;C:ESCRT I complex;MFPO C.G. S.X.
0.14 2e-2 40 At2g47170 819330 ARF1A1C Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. C.G. S.X.
0.04 3e-1 36 At3g22950 821868 ATARFC1 (ADP-ribosylation factor C1) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor GB:P91924 (Dugesia japonica), other ARFs and ARF-like proteins. C.G. S.X.
0.02 1e+0 34 At5g02900 831752 CYP96A13 member of CYP96A C.G. S.X.
Click here to hide the above table.

Orthologous genes

Click Gene ID to show a list of orthologous genes.

HF Ev BS Species Gene ID Repr. ID Gene Name Functional description Ev AGI code Arabidopsis gene name C.G. S.X. Other DB
0.42 1e-44 180 Glycine max Gma.4171.1.S1_at CD401267 - - 1e-79 At5g17060 ATARFB1B C.G. S.X.
0.38 1e-41 169 Hordeum vulgare Contig10896_at Contig10896 - - 5e-41 At3g03120 ATARFB1C (ADP-ribosylation factor B1C) C.G. S.X.
0.34 1e-32 141 Oryza sativa Os10g0580200 AK070151.1 - ADP-ribosylation factor (Fragment) 1e-32 At3g03120 ATARFB1C (ADP-ribosylation factor B1C) C.G. S.X.
0.49 1e-47 190 Populus trichocarpa Ptp.5435.1.A1_at CV279366 hypothetical protein - 4e-85 At5g17060 ATARFB1B C.G. S.X.
0.34 7e-27 121 Triticum aestivum TaAffx.86027.1.S1_at CA617493 - - 6e-27 At3g03120 ATARFB1C (ADP-ribosylation factor B1C) C.G. S.X.
0.49 6e-80 295 Vitis vinifera 1606718_at CA817648 hypothetical protein LOC100254624 - 2e-93 At5g17060 ATARFB1B C.G. S.X.
0.25 2e-34 145 Zea mays Zm.6240.1.A1_at CA405024 hypothetical protein LOC100192068 - 1e-33 At3g03120 ATARFB1C (ADP-ribosylation factor B1C) C.G. S.X.
Click here to hide the above table.

Biological processes

Click GO ID to show a list of genes that are associated with the GO ID.

ECC GO ID Process Name
Click here to hide the above table.

Metabolic pathways

Click KaPPA-View ID to show a list of genes that are assigned to the KaPPA-View ID.

KaPPA-View ID Link to Kappa-View Pathway Name

Click KEGG PATHWAY ID to show a list of genes that are assigned to the KEGG PATHWAY ID.

KEGG PATHWAY ID Link to KEGG PATHWAY Pathway Name
Click here to hide the above table.

Back to the CoP portal site

Back to the KAGIANA project homepage