Co-expression analysis

Gene ID TaAffx.85941.1.S1_at
Gene name
Homology with ArabidopsisSimilar to At5g23760: heavy-metal-associated domain-containing protein (HF=2e+1)
Module size 6 genes
NF 0.54
%ile 80.8

Co-expressed genes

Click gene/probe ID to show a list of genes that are co-expressed with the gene.

VF %ile CC Gene ID Repr. ID Gene name Func.EvAGI codeArabidopsis gene name O.I. H.G. S.X. Other DB
0.9198.20.96TaAffx.85941.1.S1_atCA618291--2e+1At5g23760heavy-metal-associated domain-containing proteinO.I.H.G.S.X.
0.6383.10.95TaAffx.109175.2.S1_x_atCA679138--1e+0At4g29020glycine-rich proteinO.I.H.G.S.X.
0.6081.00.96Ta.18019.2.S1_atCA625748--1e+0At1g32700zinc-binding family proteinO.I.H.G.S.X.
0.5072.40.96TaAffx.110167.1.S1_atCA662870--4e+0At4g14440HCD1 (3-HYDROXYACYL-COA DEHYDRATASE 1)O.I.H.G.S.X.
0.3142.70.96Ta.6759.2.S1_atBJ211299--2e+0At5g63310NDPK2 (NUCLEOSIDE DIPHOSPHATE KINASE 2)O.I.H.G.S.X.
0.2227.10.96Ta.3911.2.S1_s_atCA604151--4e+0At2g44290protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (YLS3)O.I.H.G.S.X.

Click More genes



Specific experiments for the module

Std2 GX %ile GSM ID Assay name GSE ID Experiment title Link to GEO
16.799.6GSM298070Leaf tissue of Paragon at 9 weeks post germination, biological rep 2GSE11774Expression data from cold treated wheat cultivarsLink to GEO
9.699.1GSM298092Crown tissue of Solstice at 3 weeks post germinationGSE11774Expression data from cold treated wheat cultivarsLink to GEO
7.398.6GSM250900TcLr34_3dpi_inoculated_rep3GSE9915Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheatLink to GEO
6.898.4GSM298067Leaf tissue of Paragon at 5 weeks post germination, biological rep 1GSE11774Expression data from cold treated wheat cultivarsLink to GEO
6.398.2GSM298091Leaf tissue of Solstice at 9 weeks post germinationGSE11774Expression data from cold treated wheat cultivarsLink to GEO
6.098.0GSM298090Leaf tissue of Solstice at 5 weeks post germinationGSE11774Expression data from cold treated wheat cultivarsLink to GEO
5.297.5GSM250898TcLr1_3dpi_inoculated_rep3GSE9915Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheatLink to GEO
5.297.5GSM250895Tc_3dpi_mock_rep3GSE9915Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheatLink to GEO
5.097.4GSM298079Leaf tissue of Solstice at 5 weeks post germination, biological rep 1GSE11774Expression data from cold treated wheat cultivarsLink to GEO
4.697.0GSM250897TcLr1_3dpi_mock_rep3GSE9915Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheatLink to GEO

Inter-species module comparison

A co-expression module including the Arabidopsis gene, At5g23760, orthologous to the query gene, TaAffx.85941.1.S1_at

VF%ileGene IDRepr. IDGene NameFunc.O.I.H.G.S.X.Other DB
0.2319.3At5g23760832441heavy-metal-associated domain-containing proteinF:metal ion binding;P:metal ion transport;C:cellular_component unknown;OMPFABVO.I.H.G.S.X.
0.4050.8At2g23430816875ICK1Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1.O.I.H.G.S.X.
0.3338.1At3g03120821079ATARFB1C (ADP-ribosylation factor B1C)A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins.O.I.H.G.S.X.
0.2522.6At5g08210830717MIR834aEncodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAAO.I.H.G.S.X.
0.2217.5At5g64180836539unknown proteinF:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFBO.I.H.G.S.X.

Select a plant to compare co-expressed genes between species.
Glycine_max
Hordeum_vulgare
Oryza_sativa
Populus_trichocarpa
Vitis_vinifera
Zea_mays



Back to the CoP portal site

Back to the KAGIANA project homepage