CoP: Co-expressed Biological Processes

Co-expression analysis

Gene ID TaAffx.85941.1.S1_at

Gene name
Homology with Arabidopsis Similar to At5g23760: heavy-metal-associated domain-containing protein (HF=2e+1)

Module size 6 genes

NF 0.54

%ile 80.8

Co-expressed genes

Click gene/probe ID to show a list of genes that are co-expressed with the gene.

VF %ile CC Gene ID Repr. ID Gene name Func. Ev AGI code Arabidopsis gene name O.I. H.G. S.X. Other DB
0.91 98.2 0.96 TaAffx.85941.1.S1_at CA618291 - - 2e+1 At5g23760 heavy-metal-associated domain-containing protein O.I. H.G. S.X.
0.63 83.1 0.95 TaAffx.109175.2.S1_x_at CA679138 - - 1e+0 At4g29020 glycine-rich protein O.I. H.G. S.X.
0.60 81.0 0.96 Ta.18019.2.S1_at CA625748 - - 1e+0 At1g32700 zinc-binding family protein O.I. H.G. S.X.
0.50 72.4 0.96 TaAffx.110167.1.S1_at CA662870 - - 4e+0 At4g14440 HCD1 (3-HYDROXYACYL-COA DEHYDRATASE 1) O.I. H.G. S.X.
0.31 42.7 0.96 Ta.6759.2.S1_at BJ211299 - - 2e+0 At5g63310 NDPK2 (NUCLEOSIDE DIPHOSPHATE KINASE 2) O.I. H.G. S.X.
0.22 27.1 0.96 Ta.3911.2.S1_s_at CA604151 - - 4e+0 At2g44290 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (YLS3) O.I. H.G. S.X.

Click More genes

Specific experiments for the module

Std2 GX %ile GSM ID Assay name GSE ID Experiment title Link to GEO
16.7 99.6 GSM298070 Leaf tissue of Paragon at 9 weeks post germination, biological rep 2 GSE11774 Expression data from cold treated wheat cultivars
9.6 99.1 GSM298092 Crown tissue of Solstice at 3 weeks post germination GSE11774 Expression data from cold treated wheat cultivars
7.3 98.6 GSM250900 TcLr34_3dpi_inoculated_rep3 GSE9915 Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheat
6.8 98.4 GSM298067 Leaf tissue of Paragon at 5 weeks post germination, biological rep 1 GSE11774 Expression data from cold treated wheat cultivars
6.3 98.2 GSM298091 Leaf tissue of Solstice at 9 weeks post germination GSE11774 Expression data from cold treated wheat cultivars
6.0 98.0 GSM298090 Leaf tissue of Solstice at 5 weeks post germination GSE11774 Expression data from cold treated wheat cultivars
5.2 97.5 GSM250898 TcLr1_3dpi_inoculated_rep3 GSE9915 Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheat
5.2 97.5 GSM250895 Tc_3dpi_mock_rep3 GSE9915 Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheat
5.0 97.4 GSM298079 Leaf tissue of Solstice at 5 weeks post germination, biological rep 1 GSE11774 Expression data from cold treated wheat cultivars
4.6 97.0 GSM250897 TcLr1_3dpi_mock_rep3 GSE9915 Transcript profiling of Lr1- and Lr34-mediated leaf rust resistance in wheat

Inter-species module comparison

A co-expression module including the Arabidopsis gene, At5g23760, orthologous to the query gene, TaAffx.85941.1.S1_at

VF %ile Gene ID Repr. ID Gene Name Func. O.I. H.G. S.X. Other DB
0.23 19.3 At5g23760 832441 heavy-metal-associated domain-containing protein F:metal ion binding;P:metal ion transport;C:cellular_component unknown;OMPFABV O.I. H.G. S.X.
0.40 50.8 At2g23430 816875 ICK1 Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. O.I. H.G. S.X.
0.33 38.1 At3g03120 821079 ATARFB1C (ADP-ribosylation factor B1C) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. O.I. H.G. S.X.
0.25 22.6 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA O.I. H.G. S.X.
0.22 17.5 At5g64180 836539 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFB O.I. H.G. S.X.

Select a plant to compare co-expressed genes between species.
Glycine_max
Hordeum_vulgare
Oryza_sativa
Populus_trichocarpa
Vitis_vinifera
Zea_mays

Back to the CoP portal site

Back to the KAGIANA project homepage