Std2 GX %ile GSM ID Assay name GSE ID Experiment title Link to GEO 7.5 98.6 GSM440979 Stressed seed_Rep2 GSE17669 Gene expression in the barley spike during drought stress 6.6 98.2 GSM372955 genotype: Mla6 - pathogen isolates: 5874 - time: 32 - rep3 GSE14930 Comparison of wild-type and cell death mutant of barley plants containing Mla6 powdery mildew resistance gene 6.4 98.1 GSM440978 Stressed seed_Rep1 GSE17669 Gene expression in the barley spike during drought stress 6.2 98.0 GSM419982 Seed_Rep2 GSE16754 Comparative transcriptional profiling of organs of the barley spike 6.2 98.0 GSM440976 Control seed_Rep2 GSE17669 Gene expression in the barley spike during drought stress 5.9 97.9 GSM419981 Seed_Rep1 GSE16754 Comparative transcriptional profiling of organs of the barley spike 5.9 97.9 GSM440975 Control seed_Rep1 GSE17669 Gene expression in the barley spike during drought stress 5.8 97.8 GSM419983 Seed_Rep3 GSE16754 Comparative transcriptional profiling of organs of the barley spike 5.8 97.8 GSM440977 Control seed_Rep3 GSE17669 Gene expression in the barley spike during drought stress 5.8 97.8 GSM440980 Stressed seed_Rep3 GSE17669 Gene expression in the barley spike during drought stress
VF %ile Gene ID Repr. ID Gene Name Func. O.I. H.G. S.X. Other DB 0.23 19.3 At5g23760 832441 heavy-metal-associated domain-containing protein F:metal ion binding;P:metal ion transport;C:cellular_component unknown;OMPFABV O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.40 50.8 At2g23430 816875 ICK1 Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.33 38.1 At3g03120 821079 ATARFB1C (ADP-ribosylation factor B1C) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.25 22.6 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.22 17.5 At5g64180 836539 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFB O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report)
