VF %ile CC Gene ID Repr. ID Gene name Func. O.I. H.G. S.X. Other DB 0.26 24.4 1.00 At5g64180 836539 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFB O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.42 53.9 0.81 At1g49245 841348 - F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;PM O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.31 33.8 0.85 At3g03120 821079 ATARFB1C (ADP-ribosylation factor B1C) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.23 19.3 0.81 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.20 14.4 0.82 At5g62950 836415 catalytic/ nucleotide binding F:catalytic activity, nucleotide binding;P:cellular metabolic process;C:cellular_component unknown;MFPO O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.09 2.8 0.81 At1g02880 839303 TPK1 (THIAMIN PYROPHOSPHOKINASE1) Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report)
Std2 GX %ile GSM ID Assay name GSE ID Experiment title Link to GEO 186.9 100.0 E-ATMX-35-raw-cel-1574334800 149.0 99.9 E-ATMX-35-raw-cel-1574334816 130.2 99.9 E-ATMX-35-raw-cel-1574334832 93.5 99.9 E-MEXP-807-raw-cel-1173273144 85.6 99.9 E-MEXP-807-raw-cel-1173273060 84.9 99.9 E-MEXP-807-raw-cel-1173273088 74.6 99.9 E-MEXP-807-raw-cel-1173273223 73.0 99.9 E-MEXP-807-raw-cel-1173273196 71.6 99.9 E-MEXP-807-raw-cel-1173273116 68.8 99.9 E-MEXP-807-raw-cel-1173273252 65.0 99.8 E-MEXP-807-raw-cel-1173273170 19.4 99.6 GSM142740 DH001_ATH1_A7-MPG1 GSE6162 Transcriptome analysis of Arabidopsis microgametogenesis 17.5 99.5 GSM239252 Columbia glabrous (C24) wild type stamen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 16.9 99.5 GSM239253 CaMV::DME pollen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 14.7 99.4 GSM142649 MC002_ATH1_A9.3-dubos-aah GSE6151 The mechanisms involved in the interplay between dormancy and secondary growth in Arabidopsis 14.5 99.4 GSM142736 DH001_ATH1_A3-TCP1 GSE6162 Transcriptome analysis of Arabidopsis microgametogenesis 14.2 99.4 GSM239251 Columbia glabrous (C24) wild type pollen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 14.0 99.4 E-ATMX-35-raw-cel-1574334880 13.8 99.4 GSM142647 MC002_ATH1_A9.1-dubos-aah GSE6151 The mechanisms involved in the interplay between dormancy and secondary growth in Arabidopsis 13.0 99.4 GSM142648 MC002_ATH1_A9.2-dubos-aah GSE6151 The mechanisms involved in the interplay between dormancy and secondary growth in Arabidopsis 12.3 99.3 GSM39198 RRE1_Chitin4 GSE2169 rre1 and rre2 mutants 11.7 99.3 GSM134457 St.Clair_1-82_294_Mt-0_0.30mM-SA-in-0.02%-silwet_Rep1_ATH1 GSE5758 Expression Level Polymorphism Project (ELP) - Mt-0 11.6 99.3 GSM39197 RRE1_Chitin3 GSE2169 rre1 and rre2 mutants 11.3 99.3 E-MEXP-1138-raw-cel-1432772618 10.6 99.2 E-MEXP-1138-raw-cel-1432773066 10.1 99.2 E-MEXP-1138-raw-cel-1432773322 10.1 99.2 GSM142654 MC002_ATH1_A11.2-dubos-mxh GSE6151 The mechanisms involved in the interplay between dormancy and secondary growth in Arabidopsis 10.0 99.2 E-MEXP-1138-raw-cel-1432772554 10.0 99.2 GSM39213 RRE2_Chitin3 GSE2169 rre1 and rre2 mutants 9.9 99.1 E-MEXP-1138-raw-cel-1432772650 9.8 99.1 E-MEXP-1138-raw-cel-1432772682 9.7 99.1 E-MEXP-1138-raw-cel-1432773290 9.6 99.1 E-MEXP-1138-raw-cel-1432772586 9.6 99.1 GSM142653 MC002_ATH1_A11.1-dubos-mxh GSE6151 The mechanisms involved in the interplay between dormancy and secondary growth in Arabidopsis 9.5 99.1 GSM13783 Dexamethasone plus cycloheximide - replicate GSE911 Identification of LEAFY targets during reproductive transition 9.3 99.1 GSM142655 MC002_ATH1_A11.3-dubos-mxh GSE6151 The mechanisms involved in the interplay between dormancy and secondary growth in Arabidopsis 9.3 99.1 GSM154503 Arabidopsis desiccated mature pollen grains rep1 GSE6696 Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis 9.2 99.1 GSM39196 RRE1_Chitin2 GSE2169 rre1 and rre2 mutants 9.0 99.1 GSM339543 Environmental regulation of leaf colour in red 35S:PAP1 Arabidopsis -5 GSE13469 Environmental regulation of leaf colour in red 35S:PAP1 Arabidopsis 9.0 99.1 E-MEXP-1138-raw-cel-1432773354 9.0 99.1 E-MEXP-1138-raw-cel-1432773258 8.8 99.0 E-MEXP-1138-raw-cel-1432773034 8.8 99.0 E-MEXP-1138-raw-cel-1432773098 8.7 99.0 E-MEXP-1138-raw-cel-1432773130
: Transcription factor, 
: Binding protein, 
: Enzyme protein, 
: Other protein
: VF over 0.50, 
: over 0.25, 
