VF %ile CC Gene ID Repr. ID Gene name Func. O.I. H.G. S.X. Other DB 0.17 10.2 1.00 At3g20480 821594 tetraacyldisaccharide 4'-kinase family protein F:tetraacyldisaccharide 4'-kinase activity;P:lipid A biosynthetic process;C:membrane;OBPM O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.50 65.3 0.82 At3g47910 823946 ubiquitin thiolesterase/ zinc ion binding F:ubiquitin thiolesterase activity, zinc ion binding;P:ubiquitin-dependent protein catabolic process;C:intracellular;MOFPBAV O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.47 61.2 0.83 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.33 38.1 0.82 At3g03120 821079 ATARFB1C (ADP-ribosylation factor B1C) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.25 22.6 0.82 At2g30120 817564 unknown protein F:unknown;P:unknown;C:unknown;POMBAF O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report)
Std2 GX %ile GSM ID Assay name GSE ID Experiment title Link to GEO 225.2 100.0 E-ATMX-35-raw-cel-1574334800 179.0 100.0 E-ATMX-35-raw-cel-1574334816 156.4 99.9 E-ATMX-35-raw-cel-1574334832 35.8 99.7 GSM253648 Col-0-1 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 29.8 99.7 GSM253646 Low_Mo_seg_pool_Ler_col_F2 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 26.6 99.7 GSM253649 Col-0-2 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 24.2 99.6 GSM253645 High_Mo_seg_pool_Ler_col_F2 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 23.9 99.6 GSM133762 Lindsey_1-14_torpedo-root_Rep1_ATH1 GSE5730 Transcriptional profiling of laser-capture micro-dissected embryonic tissues 23.3 99.6 GSM142740 DH001_ATH1_A7-MPG1 GSE6162 Transcriptome analysis of Arabidopsis microgametogenesis 22.4 99.6 GSM205364 met1-3_leaf_second-selfed generation_rep01 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 21.2 99.6 GSM239252 Columbia glabrous (C24) wild type stamen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 20.3 99.6 GSM239253 CaMV::DME pollen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 18.7 99.5 GSM184537 Whole roots 2hr KCl control treated then frozen, biological rep1 GSE7631 Cell-specific nitrogen responses in the Arabidopsis root 18.6 99.5 GSM253647 Col-0 3 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 18.6 99.5 GSM205426 met1-3_leaf_second-selfed generation_rep02 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 17.4 99.5 GSM142736 DH001_ATH1_A3-TCP1 GSE6162 Transcriptome analysis of Arabidopsis microgametogenesis 17.1 99.5 GSM239251 Columbia glabrous (C24) wild type pollen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 17.0 99.5 E-ATMX-35-raw-cel-1574334880 16.1 99.5 GSM143298 Low_Na_seg_pool_ts_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 15.4 99.5 GSM143307 Low_Na_seg_pool_tsu_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 15.4 99.5 GSM253652 Ler 2 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 15.3 99.4 GSM205430 met1-3_leaf_fourth-selfed generation_rep02 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 14.8 99.4 GSM184551 Whole roots 2hr KCl control treated then incubated in protoplast-generating solution minus enzymes, biological rep1 GSE7631 Cell-specific nitrogen responses in the Arabidopsis root 14.4 99.4 GSM253650 Ler 3 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 13.6 99.4 E-MEXP-1138-raw-cel-1432772618 13.6 99.4 GSM143306 High_Na_seg_pool_tsu_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 13.2 99.4 GSM226530 LCOLUMELLASB GSE8934 A high resolution organ expression map reveals novel expression patterns and predicts cellular function 13.1 99.4 GSM205428 met1-3_leaf_fourth-selfed generation_rep01 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 12.9 99.3 E-MEXP-1138-raw-cel-1432773066 12.2 99.3 E-MEXP-1138-raw-cel-1432773322 12.0 99.3 E-MEXP-1138-raw-cel-1432772554 11.9 99.3 GSM253651 Ler 1 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 11.9 99.3 E-MEXP-1138-raw-cel-1432772650 11.8 99.3 E-MEXP-1138-raw-cel-1432772682 11.6 99.3 E-MEXP-1138-raw-cel-1432773290 11.5 99.3 E-MEXP-1138-raw-cel-1432772586 11.2 99.2 GSM154503 Arabidopsis desiccated mature pollen grains rep1 GSE6696 Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis 11.0 99.2 GSM143309 Tsu_genomic_hyb_2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 10.8 99.2 E-MEXP-1138-raw-cel-1432773258 10.8 99.2 E-MEXP-1138-raw-cel-1432773354 10.7 99.2 E-MEXP-1138-raw-cel-1432773034 10.5 99.2 GSM143299 High_Na_seg_pool_ts_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 10.5 99.2 E-MEXP-1138-raw-cel-1432773098 10.5 99.2 E-MEXP-1138-raw-cel-1432773130 10.2 99.2 GSM311291 Laser capture microdissected (LCM) chalazal endosperm at the linear-cotyledon stage, biological replicate 1 GSE12403 Expression data from Arabidopsis seed compartments at the linear-cotyledon stage 9.9 99.1 E-MEXP-1138-raw-cel-1432772522 9.8 99.1 GSM131636 ATGE_73_A GSE5632 AtGenExpress: Developmental series (flowers and pollen) 9.8 99.1 GSM143300 Ts_genomic_hyb_3 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 9.7 99.1 GSM143301 Ts_genomic_hyb_2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 9.0 99.1 E-MEXP-1138-raw-cel-1432773002 8.8 99.0 GSM143308 Tsu_genomic_hyb_3 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 8.7 99.0 GSM311292 Laser capture microdissected (LCM) chalazal endosperm at the linear-cotyledon stage, biological replicate 2 GSE12403 Expression data from Arabidopsis seed compartments at the linear-cotyledon stage
: Transcription factor, 
: Binding protein, 
: Enzyme protein, 
: Other protein
: VF over 0.50, 
: over 0.25, 
