VF %ile CC Gene ID Repr. ID Gene name Func. O.I. H.G. S.X. Other DB 0.50 65.3 1.00 At3g03120 821079 ATARFB1C (ADP-ribosylation factor B1C) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.75 86.9 0.84 At5g40920 3771388 - F:unknown;P:unknown;C:unknown O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.60 75.7 0.84 At5g08210 830717 MIR834a Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.50 65.3 0.83 At3g05080 819670 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.50 65.3 0.84 At4g17960 827521 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report) 0.38 46.7 0.83 At4g31030 829230 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P O.I. H.G. S.X. Please select TAIR (integral) KEGG (integral) PlantTribes (integral) Gramene (integral) MPSS (genome) InParanoid (ortholog) Plant RBP (ortholog) SIGnAL (T-DNA) RAFL (full-length clone) AtGDB (genome) Genevestigator (expression) eFP Browser (expression) AVT (expression) ATTED-II (co-expression) AtcisDB (cis-element) SUBA (hydropathy) AtProteome Plant Proteome Database PMN (pathway) KaPPA-View 4 (pathway) RnR (over-expression) iHOP (report)
Std2 GX %ile GSM ID Assay name GSE ID Experiment title Link to GEO 190.6 100.0 E-ATMX-35-raw-cel-1574334800 152.0 99.9 E-ATMX-35-raw-cel-1574334816 132.8 99.9 E-ATMX-35-raw-cel-1574334832 95.9 99.9 GSM205430 met1-3_leaf_fourth-selfed generation_rep02 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 87.3 99.9 GSM133762 Lindsey_1-14_torpedo-root_Rep1_ATH1 GSE5730 Transcriptional profiling of laser-capture micro-dissected embryonic tissues 72.7 99.9 GSM184537 Whole roots 2hr KCl control treated then frozen, biological rep1 GSE7631 Cell-specific nitrogen responses in the Arabidopsis root 71.6 99.9 GSM205428 met1-3_leaf_fourth-selfed generation_rep01 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 62.4 99.8 GSM253646 Low_Mo_seg_pool_Ler_col_F2 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 39.5 99.8 GSM184551 Whole roots 2hr KCl control treated then incubated in protoplast-generating solution minus enzymes, biological rep1 GSE7631 Cell-specific nitrogen responses in the Arabidopsis root 38.7 99.8 GSM205364 met1-3_leaf_second-selfed generation_rep01 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 31.6 99.7 E-MEXP-739-raw-cel-1099467384 26.1 99.7 GSM143307 Low_Na_seg_pool_tsu_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 24.8 99.6 GSM143298 Low_Na_seg_pool_ts_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 22.6 99.6 GSM176876 AWP_AL_Txed_1 GSE7334 Microarray Analysis of Arabidopsis Genome Response to Aluminum Stress 21.4 99.6 GSM253645 High_Mo_seg_pool_Ler_col_F2 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 20.2 99.6 GSM205426 met1-3_leaf_second-selfed generation_rep02 GSE8279 Transgenerational Stability of the Arabidopsis Epigenome Is Coordinated by CG Methylation 19.7 99.6 GSM143299 High_Na_seg_pool_ts_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 19.4 99.6 GSM142740 DH001_ATH1_A7-MPG1 GSE6162 Transcriptome analysis of Arabidopsis microgametogenesis 17.5 99.5 GSM239252 Columbia glabrous (C24) wild type stamen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 16.9 99.5 E-MEXP-739-raw-cel-1099467375 16.9 99.5 GSM239253 CaMV::DME pollen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 16.2 99.5 GSM270870 Arabidopsis cell culture, 4 h_response to phytoprostane A1_rep3 GSE10719 Response of Arabidopsis cell culture to phytoprostane A1 15.8 99.5 GSM270868 Arabidopsis cell culture, 4 h_response to phytoprostane A1_rep2 GSE10719 Response of Arabidopsis cell culture to phytoprostane A1 15.7 99.5 E-MEXP-849-raw-cel-1181980942 14.5 99.4 GSM142736 DH001_ATH1_A3-TCP1 GSE6162 Transcriptome analysis of Arabidopsis microgametogenesis 14.3 99.4 GSM239251 Columbia glabrous (C24) wild type pollen GSE9408 Identification of putative Arabidopsis DEMETER target genes by GeneChip Analysis 14.1 99.4 E-ATMX-35-raw-cel-1574334880 13.9 99.4 GSM270866 Arabidopsis cell culture, 4 h_response to phytoprostane A1_rep1 GSE10719 Response of Arabidopsis cell culture to phytoprostane A1 13.8 99.4 GSM143310 Tsu_genomic_hyb_1 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 13.2 99.4 E-MEXP-849-raw-cel-1181980934 12.6 99.3 GSM253649 Col-0-2 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 12.1 99.3 GSM253647 Col-0 3 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 11.7 99.3 GSM143306 High_Na_seg_pool_tsu_col_F2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 11.6 99.3 E-MEXP-739-raw-cel-1099467393 11.6 99.3 E-MEXP-849-raw-cel-1181980894 11.3 99.3 E-MEXP-1138-raw-cel-1432772618 11.3 99.3 GSM143301 Ts_genomic_hyb_2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 10.6 99.2 E-MEXP-1138-raw-cel-1432773066 10.4 99.2 GSM143308 Tsu_genomic_hyb_3 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 10.3 99.2 GSM143309 Tsu_genomic_hyb_2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 10.3 99.2 GSM253648 Col-0-1 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 10.1 99.2 E-MEXP-1138-raw-cel-1432773322 10.0 99.2 E-MEXP-1138-raw-cel-1432772554 10.0 99.2 GSM253651 Ler 1 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 9.9 99.1 E-MEXP-1138-raw-cel-1432772650 9.8 99.1 E-MEXP-1138-raw-cel-1432772682 9.7 99.1 GSM143302 Ts_genomic_hyb_1 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1 9.7 99.1 E-MEXP-1138-raw-cel-1432773290 9.6 99.1 E-MEXP-1138-raw-cel-1432772586 9.3 99.1 GSM154503 Arabidopsis desiccated mature pollen grains rep1 GSE6696 Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis 9.0 99.1 E-MEXP-1138-raw-cel-1432773354 9.0 99.1 E-MEXP-1138-raw-cel-1432773258 8.8 99.0 E-MEXP-1138-raw-cel-1432773034 8.8 99.0 E-MEXP-1138-raw-cel-1432773098 8.7 99.0 E-MEXP-1138-raw-cel-1432773130 8.6 99.0 GSM253650 Ler 3 GSE10039 Low_Mo_Arabidopsis_mapping_MOT1 8.6 99.0 E-MEXP-849-raw-cel-1181980950
: Transcription factor, 
: Binding protein, 
: Enzyme protein, 
: Other protein
: VF over 0.50, 
: over 0.25, 
