CoP: Co-expressed Biological Processes

Co-expression analysis

Gene ID At1g02880

Gene name TPK1 (THIAMIN PYROPHOSPHOKINASE1)

Module size 5 genes

NF 0.20

%ile 18.5

Co-expression network

: Transcription factor, : Binding protein, : Enzyme protein, : Other protein
: VF over 0.50, : over 0.25, : below 0.25

Co-expressed genes

Click gene/probe ID to show a list of genes that are co-expressed with the gene.

VF %ile CC Gene ID Repr. ID Gene name Func. O.I. H.G. S.X. Other DB
0.21 15.8 1.00 At1g02880 839303 TPK1 (THIAMIN PYROPHOSPHOKINASE1) Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. O.I. H.G. S.X.
0.57 73.8 0.84 At5g09690 830828 magnesium transporter CorA-like family protein (MRS2-7) F:metal ion transmembrane transporter activity;P:metal ion transport;C:membrane;PFOMB O.I. H.G. S.X.
0.31 33.8 0.82 At3g03120 821079 ATARFB1C (ADP-ribosylation factor B1C) A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. O.I. H.G. S.X.
0.22 17.5 0.81 At5g64180 836539 unknown protein F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;MPOFB O.I. H.G. S.X.
0.08 2.3 0.81 At3g20480 821594 tetraacyldisaccharide 4'-kinase family protein F:tetraacyldisaccharide 4'-kinase activity;P:lipid A biosynthetic process;C:membrane;OBPM O.I. H.G. S.X.

VF	%ile	CC	Gene ID	Repr. ID	Gene name	Func.	O.I.	H.G.	S.X.	Other DB
0.46	59.8	0.78	At5g40920	3771388	-	F:unknown;P:unknown;C:unknown	O.I.	H.G.	S.X.
0.35	41.6	0.77	At5g08210	830717	MIR834a	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA	O.I.	H.G.	S.X.
0.33	38.1	0.80	At3g15352	820770	ATCOX17	Encodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex.	O.I.	H.G.	S.X.
0.22	17.5	0.80	At4g21865	828275	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	H.G.	S.X.
0.09	2.8	0.83	At1g02680	837962	TAF13 (TBP-ASSOCIATED FACTOR 13)	F:RNA polymerase II transcription factor activity, DNA binding;P:transcription initiation, transcription from RNA polymerase II promoter;C:transcription factor complex;FMPOV	O.I.	H.G.	S.X.
0.06	1.4	0.80	At2g36370	818210	ubiquitin-protein ligase	F:ubiquitin-protein ligase activity;P:ubiquitin-dependent protein catabolic process;C:unknown;MPFOBV	O.I.	H.G.	S.X.
0.06	1.4	0.79	At5g27460	832805	pentatricopeptide (PPR) repeat-containing protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;POFB	O.I.	H.G.	S.X.
0.05	1.1	0.85	At2g42160	818816	zinc finger (ubiquitin-hydrolase) domain-containing protein	F:protein binding, catalytic activity, zinc ion binding;P:unknown;C:unknown;MFOPB	O.I.	H.G.	S.X.
0.04	0.9	0.80	At4g30730	829196	unknown protein	F:molecular_function unknown;P:biological_process unknown;C:cellular_component unknown;P	O.I.	H.G.	S.X.
0.04	0.9	0.76	At3g51890	824352	protein binding / structural molecule	F:protein binding, structural molecule activity;P:intracellular protein transport, vesicle-mediated transport;C:clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit;MPFOB	O.I.	H.G.	S.X.

Link to AtGenExpress Visualization Tool

Specific experiments for the module

Std2 GX %ile GSM ID Assay name GSE ID Experiment title Link to GEO
91.9 99.9 E-MEXP-807-raw-cel-1173273144
70.0 99.9 E-MEXP-807-raw-cel-1173273252
59.1 99.8 E-MEXP-807-raw-cel-1173273088
58.3 99.8 E-MEXP-807-raw-cel-1173273060
54.1 99.8 E-MEXP-807-raw-cel-1173273223
50.6 99.8 E-MEXP-807-raw-cel-1173273196
48.9 99.8 E-MEXP-807-raw-cel-1173273116
35.6 99.7 E-MEXP-807-raw-cel-1173273170
10.2 99.2 GSM134457 St.Clair_1-82_294_Mt-0_0.30mM-SA-in-0.02%-silwet_Rep1_ATH1 GSE5758 Expression Level Polymorphism Project (ELP) - Mt-0
8.9 99.0 GSM143309 Tsu_genomic_hyb_2 GSE6203 Rus_etal_High_Na_Arabidopsis_accessions_mapping_HKT1
8.5 99.0 GSM133762 Lindsey_1-14_torpedo-root_Rep1_ATH1 GSE5730 Transcriptional profiling of laser-capture micro-dissected embryonic tissues

Biological processes inferred to relate to the module

SF Genes GO ID Process Name Link to AmiGO
0.286 1 GO:0006772 The chemical reactions and pathways involving thiamin (vitamin B1), a water soluble vitamin present in fresh vegetables and meats, especially liver.
0.167 1 GO:0009245 The chemical reactions and pathways resulting in the formation of lipid A, the glycolipid moiety of bacterial lipopolysaccharides, consisting of six fatty acyl chains linked to two glucosamine residues.
0.020 1 GO:0030001 The directed movement of metal ions, any metal ion with an electric charge, into, out of, within or between cells.

KEGG PATHWAY inferred to related to the module

SF Genes KEGG ID Pathway name Link to KEGG

Inter-species module comparison

Select a plant to compare co-expressed genes between species.
Glycine_max
Hordeum_vulgare
Oryza_sativa
Populus_trichocarpa
Triticum_aestivum
Vitis_vinifera
Zea_mays

Back to the CoP portal site

Back to the KAGIANA project homepage